EMAIL THIS PAGE TO A FRIEND

KIAA1984

KIAA1984

19 Gene Product Result for
Synonyms: PARF RP11-216L13.9 bA216L13.7
UniProtKB ID: Q5T5S1, B2RP89, C9JD38, Q6P2D9, Q8NAI4, Q8TF18
Gene ID:
naked mole-rat(101713462) KIAA1984 ortholog
sheep(101105995) KIAA1984 ortholog
chicken(417476) KIAA1984
cow(618673) KIAA1984 ortholog
domestic cat(101095623) KIAA1984 ortholog
dog(100683781) KIAA1984 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032874 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039374 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240466 predicted 1322
2 SASI_Hs01_00240467 predicted 1340
3 SASI_Hs01_00240468 predicted 1119
4 SASI_Hs01_00240469 predicted 1132
5 SASI_Hs01_00240470 predicted 347
6 SASI_Hs01_00240474 predicted 342
7 SASI_Hs02_00308473 predicted 1385
8 SASI_Hs02_00308474 predicted 649
9 SASI_Hs02_00308475 predicted 648
10 SASI_Hs02_00308476 predicted 683
11 SASI_Hs01_00240471 predicted 729
12 SASI_Hs01_00240472 predicted 762
13 SASI_Hs01_00240473 predicted 813
14 SASI_Hs01_00240475 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032874
KIAA1984 MISSION shRNA Bacterial Glycerol Stock
KIAA1984
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032874.2-1507s1c1
Sequence:CCGGGAGTATACCCACTGCCAACAACTCGAGTTGTTGGCAGTGGGTATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032874.2-1053s1c1
Sequence:CCGGGCAGAAGAAGCTGATCGACAACTCGAGTTGTCGATCAGCTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-814s1c1
Sequence:CCGGCAGAACATCCACCTGCTGTATCTCGAGATACAGCAGGTGGATGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-1065s1c1
Sequence:CCGGGATCGACAAGATCCACACGAACTCGAGTTCGTGTGGATCTTGTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-934s1c1
Sequence:CCGGGATATGAAGATCATGTCCCAACTCGAGTTGGGACATGATCTTCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032874.2-798s1c1
Sequence:CCGGCAAGATCATCACCAGCCAGAACTCGAGTTCTGGCTGGTGATGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-1228s1c1
Sequence:CCGGGAGAAGGTCAAGAGTGCTGTACTCGAGTACAGCACTCTTGACCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032874.2-1969s1c1
Sequence:CCGGCCTCGATTTGAACAGCAAGCTCTCGAGAGCTTGCTGTTCAAATCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032874
KIAA1984 MISSION shRNA shRNA Plasmid DNA
KIAA1984
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032874.2-1507s1c1
Sequence:CCGGGAGTATACCCACTGCCAACAACTCGAGTTGTTGGCAGTGGGTATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032874.2-1053s1c1
Sequence:CCGGGCAGAAGAAGCTGATCGACAACTCGAGTTGTCGATCAGCTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-814s1c1
Sequence:CCGGCAGAACATCCACCTGCTGTATCTCGAGATACAGCAGGTGGATGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-1065s1c1
Sequence:CCGGGATCGACAAGATCCACACGAACTCGAGTTCGTGTGGATCTTGTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-934s1c1
Sequence:CCGGGATATGAAGATCATGTCCCAACTCGAGTTGGGACATGATCTTCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032874.2-798s1c1
Sequence:CCGGCAAGATCATCACCAGCCAGAACTCGAGTTCTGGCTGGTGATGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-1228s1c1
Sequence:CCGGGAGAAGGTCAAGAGTGCTGTACTCGAGTACAGCACTCTTGACCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032874.2-1969s1c1
Sequence:CCGGCCTCGATTTGAACAGCAAGCTCTCGAGAGCTTGCTGTTCAAATCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032874
KIAA1984 MISSION shRNA Lentiviral Transduction Particles
KIAA1984
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032874.2-1507s1c1
Sequence:CCGGGAGTATACCCACTGCCAACAACTCGAGTTGTTGGCAGTGGGTATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032874.2-1053s1c1
Sequence:CCGGGCAGAAGAAGCTGATCGACAACTCGAGTTGTCGATCAGCTTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-814s1c1
Sequence:CCGGCAGAACATCCACCTGCTGTATCTCGAGATACAGCAGGTGGATGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-1065s1c1
Sequence:CCGGGATCGACAAGATCCACACGAACTCGAGTTCGTGTGGATCTTGTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-934s1c1
Sequence:CCGGGATATGAAGATCATGTCCCAACTCGAGTTGGGACATGATCTTCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032874.2-798s1c1
Sequence:CCGGCAAGATCATCACCAGCCAGAACTCGAGTTCTGGCTGGTGATGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032874.2-1228s1c1
Sequence:CCGGGAGAAGGTCAAGAGTGCTGTACTCGAGTACAGCACTCTTGACCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032874.2-1969s1c1
Sequence:CCGGCCTCGATTTGAACAGCAAGCTCTCGAGAGCTTGCTGTTCAAATCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)