EMAIL THIS PAGE TO A FRIEND

KIAA2013

KIAA2013

50 Gene Product Result for
UniProtKB ID: Q8IYS2, Q5JXC1, Q8IVF8, Q8NDI7, Q9BSY1
Gene ID:
chicken(428195) KIAA2013
domestic cat(101100823) KIAA2013 ortholog
dog(478228) KIAA2013 ortholog
domestic guinea pig(100714580) KIAA2013 ortholog
naked mole-rat(101717505) KIAA2013 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138346 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080351 MISSION® esiRNA esiRNA human KIAA2013 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138346 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140397 predicted 1370
2 SASI_Hs01_00140398 predicted 1351
3 SASI_Hs02_00363434 predicted 1129
4 SASI_Hs01_00140399 predicted 2081
5 SASI_Hs01_00140401 predicted 1652
6 SASI_Hs02_00363435 predicted 2079
7 SASI_Hs01_00140402 predicted 1577
8 SASI_Hs01_00140403 predicted 1270
9 SASI_Hs01_00140405 predicted 909
10 SASI_Hs01_00140406 predicted 2114
11 SASI_Hs01_00140400 predicted 2016
12 SASI_Hs01_00140404 predicted 2035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138346
KIAA2013 MISSION shRNA Bacterial Glycerol Stock
KIAA2013
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-1376s1c1
Sequence:CCGGCAACTATGAAGATCACTGCTTCTCGAGAAGCAGTGATCTTCATAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-2024s1c1
Sequence:CCGGCAAGCTCATCTACAACGAGTACTCGAGTACTCGTTGTAGATGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-2015s1c1
Sequence:CCGGCTTCCTCTTCAAGCTCATCTACTCGAGTAGATGAGCTTGAAGAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1283s1c1
Sequence:CCGGCCTGACGCTCTATTACATGCTCTCGAGAGCATGTAATAGAGCGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1288s1c1
Sequence:CCGGCGCTCTATTACATGCTCTCCTCTCGAGAGGAGAGCATGTAATAGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1277s1c1
Sequence:CCGGCGTGAACCTGACGCTCTATTACTCGAGTAATAGAGCGTCAGGTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-918s1c1
Sequence:CCGGCATCAGTTCCTCCTCTACTCACTCGAGTGAGTAGAGGAGGAACTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1142s1c1
Sequence:CCGGGAAGGAAATGCTGGAGCTCTTCTCGAGAAGAGCTCCAGCATTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-1631s1c1
Sequence:CCGGCAGCTATGCATTGCATGGCATCTCGAGATGCCATGCAATGCATAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-1652s1c1
Sequence:CCGGCCGCTACAAGAACGACCATATCTCGAGATATGGTCGTTCTTGTAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138346.1-2164s1c1
Sequence:CCGGGCCAGGAGCAAGGGATCCTTTCTCGAGAAAGGATCCCTTGCTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138346
KIAA2013 MISSION shRNA shRNA Plasmid DNA
KIAA2013
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-1376s1c1
Sequence:CCGGCAACTATGAAGATCACTGCTTCTCGAGAAGCAGTGATCTTCATAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-2024s1c1
Sequence:CCGGCAAGCTCATCTACAACGAGTACTCGAGTACTCGTTGTAGATGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-2015s1c1
Sequence:CCGGCTTCCTCTTCAAGCTCATCTACTCGAGTAGATGAGCTTGAAGAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1283s1c1
Sequence:CCGGCCTGACGCTCTATTACATGCTCTCGAGAGCATGTAATAGAGCGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1288s1c1
Sequence:CCGGCGCTCTATTACATGCTCTCCTCTCGAGAGGAGAGCATGTAATAGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1277s1c1
Sequence:CCGGCGTGAACCTGACGCTCTATTACTCGAGTAATAGAGCGTCAGGTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-918s1c1
Sequence:CCGGCATCAGTTCCTCCTCTACTCACTCGAGTGAGTAGAGGAGGAACTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1142s1c1
Sequence:CCGGGAAGGAAATGCTGGAGCTCTTCTCGAGAAGAGCTCCAGCATTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-1631s1c1
Sequence:CCGGCAGCTATGCATTGCATGGCATCTCGAGATGCCATGCAATGCATAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-1652s1c1
Sequence:CCGGCCGCTACAAGAACGACCATATCTCGAGATATGGTCGTTCTTGTAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138346.1-2164s1c1
Sequence:CCGGGCCAGGAGCAAGGGATCCTTTCTCGAGAAAGGATCCCTTGCTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138346
KIAA2013 MISSION shRNA Lentiviral Transduction Particles
KIAA2013
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-1376s1c1
Sequence:CCGGCAACTATGAAGATCACTGCTTCTCGAGAAGCAGTGATCTTCATAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-2024s1c1
Sequence:CCGGCAAGCTCATCTACAACGAGTACTCGAGTACTCGTTGTAGATGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-2015s1c1
Sequence:CCGGCTTCCTCTTCAAGCTCATCTACTCGAGTAGATGAGCTTGAAGAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1283s1c1
Sequence:CCGGCCTGACGCTCTATTACATGCTCTCGAGAGCATGTAATAGAGCGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1288s1c1
Sequence:CCGGCGCTCTATTACATGCTCTCCTCTCGAGAGGAGAGCATGTAATAGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1277s1c1
Sequence:CCGGCGTGAACCTGACGCTCTATTACTCGAGTAATAGAGCGTCAGGTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-918s1c1
Sequence:CCGGCATCAGTTCCTCCTCTACTCACTCGAGTGAGTAGAGGAGGAACTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138346.1-1142s1c1
Sequence:CCGGGAAGGAAATGCTGGAGCTCTTCTCGAGAAGAGCTCCAGCATTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-1631s1c1
Sequence:CCGGCAGCTATGCATTGCATGGCATCTCGAGATGCCATGCAATGCATAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138346.1-1652s1c1
Sequence:CCGGCCGCTACAAGAACGACCATATCTCGAGATATGGTCGTTCTTGTAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138346.1-2164s1c1
Sequence:CCGGGCCAGGAGCAAGGGATCCTTTCTCGAGAAAGGATCCCTTGCTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)