EMAIL THIS PAGE TO A FRIEND

KIAA2018

KIAA2018

215 Gene Product Result for
UniProtKB ID: Q68DE3, Q7Z3L9, Q8IVF3, Q9H8T4
Gene ID:
domestic guinea pig(100714393) KIAA2018 ortholog
naked mole-rat(101718241) KIAA2018 ortholog
sheep(101123595) KIAA2018 ortholog
chicken(418320) KIAA2018
domestic cat(101091041) KIAA2018 ortholog
cow(789845) KIAA2018 ortholog
dog(487980) KIAA2018 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_291062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291062 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046521 MISSION® esiRNA esiRNA human KIAA2018 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009899 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305704 predicted 2296
2 SASI_Hs01_00063879 predicted 1876
3 SASI_Hs02_00305705 predicted 5573
4 SASI_Hs01_00063881 predicted 3170
5 SASI_Hs01_00063883 predicted 6462
6 SASI_Hs01_00063884 predicted 6504
7 SASI_Hs02_00305706 predicted 1990
8 SASI_Hs02_00305707 predicted 4297
9 SASI_Hs01_00063885 predicted 6209
10 SASI_Hs02_00305708 predicted 2223
11 SASI_Hs01_00063876 predicted 1704
12 SASI_Hs01_00063877 predicted 1895
13 SASI_Hs01_00063878 predicted 6157
14 SASI_Hs01_00063880 predicted 4874
15 SASI_Hs01_00063882 predicted 2563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009899
KIAA2018 MISSION shRNA Bacterial Glycerol Stock
KIAA2018
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000425759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-2712s21c1
Sequence:CCGGCACACTAGCTAGTACTTATAACTCGAGTTATAAGTACTAGCTAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-5605s21c1
Sequence:CCGGTCTGATTGTCAGACGTTTAAACTCGAGTTTAAACGTCTGACAATCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-2241s21c1
Sequence:CCGGTACTGTAATAGGGTCTAATAACTCGAGTTATTAGACCCTATTACAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-4597s21c1
Sequence:CCGGGATGGCCTTACACGATTATTTCTCGAGAAATAATCGTGTAAGGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009899
KIAA2018 MISSION shRNA shRNA Plasmid DNA
KIAA2018
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000425759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-2712s21c1
Sequence:CCGGCACACTAGCTAGTACTTATAACTCGAGTTATAAGTACTAGCTAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-5605s21c1
Sequence:CCGGTCTGATTGTCAGACGTTTAAACTCGAGTTTAAACGTCTGACAATCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-2241s21c1
Sequence:CCGGTACTGTAATAGGGTCTAATAACTCGAGTTATTAGACCCTATTACAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-4597s21c1
Sequence:CCGGGATGGCCTTACACGATTATTTCTCGAGAAATAATCGTGTAAGGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009899
KIAA2018 MISSION shRNA Lentiviral Transduction Particles
KIAA2018
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000425759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-2712s21c1
Sequence:CCGGCACACTAGCTAGTACTTATAACTCGAGTTATAAGTACTAGCTAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-5605s21c1
Sequence:CCGGTCTGATTGTCAGACGTTTAAACTCGAGTTTAAACGTCTGACAATCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-2241s21c1
Sequence:CCGGTACTGTAATAGGGTCTAATAACTCGAGTTATTAGACCCTATTACAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009899.2-4597s21c1
Sequence:CCGGGATGGCCTTACACGATTATTTCTCGAGAAATAATCGTGTAAGGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291062
KIAA2018 MISSION shRNA Bacterial Glycerol Stock
KIAA2018
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-5963s1c1
Sequence:CCGGGCCCACAAGTACCTAATGATACTCGAGTATCATTAGGTACTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-415s1c1
Sequence:CCGGCCTGTATCTATTTCTGGAGTTCTCGAGAACTCCAGAAATAGATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-6517s1c1
Sequence:CCGGCCTGCCCATAACATAAGCCATCTCGAGATGGCTTATGTTATGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-1944s1c1
Sequence:CCGGCCTGAATACATTTGGTGCTTTCTCGAGAAAGCACCAAATGTATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-3352s1c1
Sequence:CCGGCCACCCTTCAAATCACAGATACTCGAGTATCTGTGATTTGAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291062
KIAA2018 MISSION shRNA shRNA Plasmid DNA
KIAA2018
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-5963s1c1
Sequence:CCGGGCCCACAAGTACCTAATGATACTCGAGTATCATTAGGTACTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-415s1c1
Sequence:CCGGCCTGTATCTATTTCTGGAGTTCTCGAGAACTCCAGAAATAGATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-6517s1c1
Sequence:CCGGCCTGCCCATAACATAAGCCATCTCGAGATGGCTTATGTTATGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-1944s1c1
Sequence:CCGGCCTGAATACATTTGGTGCTTTCTCGAGAAAGCACCAAATGTATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-3352s1c1
Sequence:CCGGCCACCCTTCAAATCACAGATACTCGAGTATCTGTGATTTGAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291062
KIAA2018 MISSION shRNA Lentiviral Transduction Particles
KIAA2018
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-5963s1c1
Sequence:CCGGGCCCACAAGTACCTAATGATACTCGAGTATCATTAGGTACTTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-415s1c1
Sequence:CCGGCCTGTATCTATTTCTGGAGTTCTCGAGAACTCCAGAAATAGATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-6517s1c1
Sequence:CCGGCCTGCCCATAACATAAGCCATCTCGAGATGGCTTATGTTATGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-1944s1c1
Sequence:CCGGCCTGAATACATTTGGTGCTTTCTCGAGAAAGCACCAAATGTATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291062.4-3352s1c1
Sequence:CCGGCCACCCTTCAAATCACAGATACTCGAGTATCTGTGATTTGAAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)