EMAIL THIS PAGE TO A FRIEND

KIAA2022

KIAA2022

328 Gene Product Result for
UniProtKB ID: Q5QGS0, A7YY87, Q5JUX9, Q8IVE9
Gene ID:
Human(340533) Summary: An inversion on the X chromosome which disrupts this gene and a G-protein coupled purinergic receptor gene located in the pseudoautosomal region of the X chromosome has been linked to X linked mental retardation.[provided by RefSeq, Mar 2009]
chicken(422325) KIAA2022
cow(512493) KIAA2022 ortholog
domestic cat(101099781) KIAA2022 ortholog
dog(491966) KIAA2022 ortholog
sheep(101113466) KIAA2022 ortholog
domestic guinea pig(100725208) KIAA2022 ortholog
naked mole-rat(101722993) KIAA2022 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008537 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008537 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162487 predicted 3659
2 SASI_Hs01_00162488 predicted 4470
3 SASI_Hs01_00162489 predicted 2648
4 SASI_Hs01_00162490 predicted 4616
5 SASI_Hs01_00162492 predicted 571
6 SASI_Hs01_00162493 predicted 2947
7 SASI_Hs02_00305494 predicted 4056
8 SASI_Hs01_00162494 predicted 3096
9 SASI_Hs02_00305495 predicted 2733
10 SASI_Hs01_00162496 predicted 1046
11 SASI_Hs01_00162491 predicted 803
12 SASI_Hs01_00162495 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008537
KIAA2022 MISSION shRNA Bacterial Glycerol Stock
KIAA2022
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008537.1-2242s1c1
Sequence:CCGGCCATTGAAATTTCAGCAAGTACTCGAGTACTTGCTGAAATTTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-1682s21c1
Sequence:CCGGCAAGGACTGTAGTCGCTATATCTCGAGATATAGCGACTACAGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008537.1-9778s21c1
Sequence:CCGGTTGAGAGATGACTGGTTATTTCTCGAGAAATAACCAGTCATCTCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-2714s21c1
Sequence:CCGGTGCTAATGTTACCACTAATATCTCGAGATATTAGTGGTAACATTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-4233s21c1
Sequence:CCGGGATGATGACCAACGGGAATTTCTCGAGAAATTCCCGTTGGTCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-4614s21c1
Sequence:CCGGATGAGCACTTTAGGCAATAACCTCGAGGTTATTGCCTAAAGTGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008537.1-1301s1c1
Sequence:CCGGGCAGGAAGATGCCCAATTCAACTCGAGTTGAATTGGGCATCTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008537
KIAA2022 MISSION shRNA shRNA Plasmid DNA
KIAA2022
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008537.1-2242s1c1
Sequence:CCGGCCATTGAAATTTCAGCAAGTACTCGAGTACTTGCTGAAATTTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-1682s21c1
Sequence:CCGGCAAGGACTGTAGTCGCTATATCTCGAGATATAGCGACTACAGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008537.1-9778s21c1
Sequence:CCGGTTGAGAGATGACTGGTTATTTCTCGAGAAATAACCAGTCATCTCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-2714s21c1
Sequence:CCGGTGCTAATGTTACCACTAATATCTCGAGATATTAGTGGTAACATTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-4233s21c1
Sequence:CCGGGATGATGACCAACGGGAATTTCTCGAGAAATTCCCGTTGGTCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-4614s21c1
Sequence:CCGGATGAGCACTTTAGGCAATAACCTCGAGGTTATTGCCTAAAGTGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008537.1-1301s1c1
Sequence:CCGGGCAGGAAGATGCCCAATTCAACTCGAGTTGAATTGGGCATCTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008537
KIAA2022 MISSION shRNA Lentiviral Transduction Particles
KIAA2022
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008537.1-2242s1c1
Sequence:CCGGCCATTGAAATTTCAGCAAGTACTCGAGTACTTGCTGAAATTTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-1682s21c1
Sequence:CCGGCAAGGACTGTAGTCGCTATATCTCGAGATATAGCGACTACAGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008537.1-9778s21c1
Sequence:CCGGTTGAGAGATGACTGGTTATTTCTCGAGAAATAACCAGTCATCTCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-2714s21c1
Sequence:CCGGTGCTAATGTTACCACTAATATCTCGAGATATTAGTGGTAACATTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-4233s21c1
Sequence:CCGGGATGATGACCAACGGGAATTTCTCGAGAAATTCCCGTTGGTCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008537.1-4614s21c1
Sequence:CCGGATGAGCACTTTAGGCAATAACCTCGAGGTTATTGCCTAAAGTGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008537.1-1301s1c1
Sequence:CCGGGCAGGAAGATGCCCAATTCAACTCGAGTTGAATTGGGCATCTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)