EMAIL THIS PAGE TO A FRIEND

KIAA2026

KIAA2026

70 Gene Product Result for
UniProtKB ID: Q5HYC2, A8MTP2, B9EGW7, Q4VXA2, Q8IVE5
Gene ID:
domestic guinea pig(100721534) KIAA2026 ortholog
naked mole-rat(101722252) KIAA2026 ortholog
sheep(101119701) KIAA2026 ortholog
chicken(427227) KIAA2026
dog(610633) KIAA2026 ortholog
cow(616937) KIAA2026 ortholog
domestic cat(101099409) KIAA2026 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002109 Anti-KIAA2026 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017969 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_088551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_088551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_088551 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011411 MISSION® esiRNA esiRNA targeting human KIAA2026 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017969 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199136 predicted 6005
2 SASI_Hs01_00199138 predicted 6031
3 SASI_Hs02_00306840 predicted 1498
4 SASI_Hs01_00199140 predicted 4349
5 SASI_Hs02_00306841 predicted 3178
6 SASI_Hs01_00199141 predicted 5492
7 SASI_Hs01_00199142 predicted 3938
8 SASI_Hs01_00199143 predicted 5175
9 SASI_Hs02_00306842 predicted 1710
10 SASI_Hs02_00306843 predicted 5591
11 SASI_Hs01_00199137 predicted 1901
12 SASI_Hs01_00199139 predicted 2437
13 SASI_Hs01_00199144 predicted 2476
14 SASI_Hs01_00199145 predicted 3617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017969
VALIDATED
KIAA2026 MISSION shRNA Bacterial Glycerol Stock
KIAA2026
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017969.2-2752s21c1
Sequence:CCGGCAACCTGATCATGATACATTTCTCGAGAAATGTATCATGATCAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-3342s21c1
Sequence:CCGGTCCGGAAGCAAGCCCGATAAACTCGAGTTTATCGGGCTTGCTTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-2094s21c1
Sequence:CCGGGATTGAACCCAGTCCATTAAACTCGAGTTTAATGGACTGGGTTCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017969.2-6604s21c1
Sequence:CCGGTACTGTTGAAAGCATACTATACTCGAGTATAGTATGCTTTCAACAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017969.2-5890s21c1
Sequence:CCGGATTAACGGAACCCGGTTTATTCTCGAGAATAAACCGGGTTCCGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-838s21c1
Sequence:CCGGGTTACATCTAGAGGCTATTATCTCGAGATAATAGCCTCTAGATGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-1759s21c1
Sequence:CCGGGACTATGTTAGTACAAGTAATCTCGAGATTACTTGTACTAACATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-4669s21c1
Sequence:CCGGGGCAATGGAACTGCAATTAATCTCGAGATTAATTGCAGTTCCATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017969
VALIDATED
KIAA2026 MISSION shRNA shRNA Plasmid DNA
KIAA2026
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017969.2-2752s21c1
Sequence:CCGGCAACCTGATCATGATACATTTCTCGAGAAATGTATCATGATCAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-3342s21c1
Sequence:CCGGTCCGGAAGCAAGCCCGATAAACTCGAGTTTATCGGGCTTGCTTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-2094s21c1
Sequence:CCGGGATTGAACCCAGTCCATTAAACTCGAGTTTAATGGACTGGGTTCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017969.2-6604s21c1
Sequence:CCGGTACTGTTGAAAGCATACTATACTCGAGTATAGTATGCTTTCAACAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017969.2-5890s21c1
Sequence:CCGGATTAACGGAACCCGGTTTATTCTCGAGAATAAACCGGGTTCCGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-838s21c1
Sequence:CCGGGTTACATCTAGAGGCTATTATCTCGAGATAATAGCCTCTAGATGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-1759s21c1
Sequence:CCGGGACTATGTTAGTACAAGTAATCTCGAGATTACTTGTACTAACATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-4669s21c1
Sequence:CCGGGGCAATGGAACTGCAATTAATCTCGAGATTAATTGCAGTTCCATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017969
VALIDATED
KIAA2026 MISSION shRNA Lentiviral Transduction Particles
KIAA2026
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017969.2-2752s21c1
Sequence:CCGGCAACCTGATCATGATACATTTCTCGAGAAATGTATCATGATCAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-3342s21c1
Sequence:CCGGTCCGGAAGCAAGCCCGATAAACTCGAGTTTATCGGGCTTGCTTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-2094s21c1
Sequence:CCGGGATTGAACCCAGTCCATTAAACTCGAGTTTAATGGACTGGGTTCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017969.2-6604s21c1
Sequence:CCGGTACTGTTGAAAGCATACTATACTCGAGTATAGTATGCTTTCAACAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017969.2-5890s21c1
Sequence:CCGGATTAACGGAACCCGGTTTATTCTCGAGAATAAACCGGGTTCCGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-838s21c1
Sequence:CCGGGTTACATCTAGAGGCTATTATCTCGAGATAATAGCCTCTAGATGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-1759s21c1
Sequence:CCGGGACTATGTTAGTACAAGTAATCTCGAGATTACTTGTACTAACATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017969.2-4669s21c1
Sequence:CCGGGGCAATGGAACTGCAATTAATCTCGAGATTAATTGCAGTTCCATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_088551
KIAA2026 MISSION shRNA Bacterial Glycerol Stock
KIAA2026
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-3567s1c1
Sequence:CCGGCCCACAGACAACAAATATAAACTCGAGTTTATATTTGTTGTCTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-4998s1c1
Sequence:CCGGGCCATTGTCAACAAGTGGTAACTCGAGTTACCACTTGTTGACAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-5106s1c1
Sequence:CCGGGCTTTCAGTTACCGGAGCAAACTCGAGTTTGCTCCGGTAACTGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-5870s1c1
Sequence:CCGGGCAGCCATGTTCTCCTTATATCTCGAGATATAAGGAGAACATGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-1517s1c1
Sequence:CCGGGCAGGGAAGTTATTCTTGGTTCTCGAGAACCAAGAATAACTTCCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_088551
KIAA2026 MISSION shRNA shRNA Plasmid DNA
KIAA2026
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-3567s1c1
Sequence:CCGGCCCACAGACAACAAATATAAACTCGAGTTTATATTTGTTGTCTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-4998s1c1
Sequence:CCGGGCCATTGTCAACAAGTGGTAACTCGAGTTACCACTTGTTGACAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-5106s1c1
Sequence:CCGGGCTTTCAGTTACCGGAGCAAACTCGAGTTTGCTCCGGTAACTGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-5870s1c1
Sequence:CCGGGCAGCCATGTTCTCCTTATATCTCGAGATATAAGGAGAACATGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-1517s1c1
Sequence:CCGGGCAGGGAAGTTATTCTTGGTTCTCGAGAACCAAGAATAACTTCCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_088551
KIAA2026 MISSION shRNA Lentiviral Transduction Particles
KIAA2026
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-3567s1c1
Sequence:CCGGCCCACAGACAACAAATATAAACTCGAGTTTATATTTGTTGTCTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-4998s1c1
Sequence:CCGGGCCATTGTCAACAAGTGGTAACTCGAGTTACCACTTGTTGACAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-5106s1c1
Sequence:CCGGGCTTTCAGTTACCGGAGCAAACTCGAGTTTGCTCCGGTAACTGAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-5870s1c1
Sequence:CCGGGCAGCCATGTTCTCCTTATATCTCGAGATATAAGGAGAACATGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088551.8-1517s1c1
Sequence:CCGGGCAGGGAAGTTATTCTTGGTTCTCGAGAACCAAGAATAACTTCCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)