EMAIL THIS PAGE TO A FRIEND

KIDINS220

kinase D-interacting substrate, 220kDa

207 Gene Product Result for
Synonyms: ARMS
Gene ID:
Mouse(77480) kinase D-interacting substrate 220
Rat(116478) kinase D-interacting substrate 220
chicken(421924) kinase D-interacting substrate, 220kDa
cow(536267) kinase D-interacting substrate, 220kDa
domestic cat(101096227) kinase D-interacting substrate, 220kDa
dog(475657) kinase D-interacting substrate, 220kDa
domestic guinea pig(100729234) kinase D-interacting substrate, 220kDa
naked mole-rat(101706736) kinase D-interacting substrate, 220kDa
sheep(101115774) kinase D-interacting substrate, 220kDa
Domestic Rabbit(100354080) kinase D-interacting substrate, 220kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_126866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_291015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291015 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020738 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020738 Rosetta Predictions human pricing
NM_053795 Rosetta Predictions rat pricing
NM_001081378 Rosetta Predictions mouse pricing
XM_001004863 Rosetta Predictions mouse pricing
XM_001004865 Rosetta Predictions mouse pricing
XM_902478 Rosetta Predictions mouse pricing
XM_902479 Rosetta Predictions mouse pricing
XM_902484 Rosetta Predictions mouse pricing
XM_902485 Rosetta Predictions mouse pricing
XM_902487 Rosetta Predictions mouse pricing
XM_902490 Rosetta Predictions mouse pricing
XM_902491 Rosetta Predictions mouse pricing
XM_902492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159793 predicted 3188
2 SASI_Hs01_00159794 predicted 787
3 SASI_Hs01_00159795 predicted 4121
4 SASI_Hs01_00159796 predicted 1719
5 SASI_Hs01_00159798 predicted 1094
6 SASI_Hs02_00353833 predicted 1428
7 SASI_Hs01_00159800 predicted 634
8 SASI_Hs01_00159801 predicted 329
9 SASI_Hs01_00159802 predicted 4298
10 SASI_Hs02_00353834 predicted 478
11 SASI_Hs01_00159797 predicted 364
12 SASI_Hs01_00159799 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061673 predicted 5308
2 SASI_Rn01_00061674 predicted 2516
3 SASI_Rn01_00061675 predicted 2592
4 SASI_Rn02_00266604 predicted 429
5 SASI_Rn02_00266605 predicted 5481
6 SASI_Rn01_00061676 predicted 3821
7 SASI_Rn01_00061677 predicted 1667
8 SASI_Rn01_00061678 predicted 3127
9 SASI_Rn01_00061679 predicted 1422
10 SASI_Rn01_00061680 predicted 3008
11 SASI_Rn01_00061681 predicted 1009
12 SASI_Rn01_00061682 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297831 predicted 381
2 SASI_Mm02_00297832 predicted 5452
3 SASI_Mm02_00297833 predicted 3015
4 SASI_Mm02_00297834 predicted 645
5 SASI_Mm02_00297835 predicted 303
6 SASI_Mm02_00297836 predicted 2643
7 SASI_Mm02_00297837 predicted 2571
8 SASI_Mm02_00297838 predicted 1728
9 SASI_Mm02_00297839 predicted 3152
10 SASI_Mm02_00297840 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269515 predicted 383
2 SASI_Mm01_00269516 predicted 5362
3 SASI_Mm01_00269517 predicted 3013
4 SASI_Mm01_00269518 predicted 654
5 SASI_Mm01_00269519 predicted 5262
6 SASI_Mm01_00269520 predicted 314
7 SASI_Mm01_00269521 predicted 2656
8 SASI_Mm01_00269522 predicted 2575
9 SASI_Mm01_00269523 predicted 1727
10 SASI_Mm01_00269524 predicted 3151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254434 predicted 388
2 SASI_Mm01_00254435 predicted 5223
3 SASI_Mm01_00254436 predicted 3015
4 SASI_Mm01_00254437 predicted 649
5 SASI_Mm01_00254438 predicted 5111
6 SASI_Mm01_00254439 predicted 311
7 SASI_Mm01_00254440 predicted 2658
8 SASI_Mm01_00254441 predicted 2574
9 SASI_Mm01_00254442 predicted 1731
10 SASI_Mm01_00254443 predicted 3159
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233937 predicted 765
2 SASI_Mm01_00233938 predicted 483
3 SASI_Mm01_00233939 predicted 328
4 SASI_Mm01_00233940 predicted 386
5 SASI_Mm01_00233941 predicted 652
6 SASI_Mm01_00233942 predicted 318
7 SASI_Mm01_00233943 predicted 222
8 SASI_Mm01_00233944 predicted 517
9 SASI_Mm01_00233945 predicted 780
10 SASI_Mm01_00233946 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269408 predicted 383
2 SASI_Mm01_00269409 predicted 4179
3 SASI_Mm01_00269410 predicted 3013
4 SASI_Mm01_00269411 predicted 653
5 SASI_Mm01_00269412 predicted 309
6 SASI_Mm01_00269413 predicted 2651
7 SASI_Mm01_00269414 predicted 2576
8 SASI_Mm01_00269415 predicted 1726
9 SASI_Mm01_00269416 predicted 3151
10 SASI_Mm01_00269417 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217593 predicted 767
2 SASI_Mm01_00217594 predicted 483
3 SASI_Mm01_00217595 predicted 325
4 SASI_Mm01_00217596 predicted 390
5 SASI_Mm01_00217597 predicted 652
6 SASI_Mm01_00217598 predicted 312
7 SASI_Mm01_00217599 predicted 227
8 SASI_Mm01_00217600 predicted 514
9 SASI_Mm01_00217601 predicted 1075
10 SASI_Mm01_00217602 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256360 predicted 391
2 SASI_Mm01_00256361 predicted 3020
3 SASI_Mm01_00256362 predicted 655
4 SASI_Mm01_00256363 predicted 314
5 SASI_Mm01_00256364 predicted 3188
6 SASI_Mm01_00256365 predicted 2649
7 SASI_Mm01_00256366 predicted 2573
8 SASI_Mm01_00256367 predicted 1728
9 SASI_Mm01_00256368 predicted 3155
10 SASI_Mm01_00256369 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207647 predicted 1319
2 SASI_Mm01_00207648 predicted 1172
3 SASI_Mm01_00207649 predicted 983
4 SASI_Mm01_00207650 predicted 998
5 SASI_Mm01_00207651 predicted 1714
6 SASI_Mm01_00207652 predicted 1868
7 SASI_Mm01_00207653 predicted 1843
8 SASI_Mm01_00207654 predicted 1601
9 SASI_Mm01_00207655 predicted 732
10 SASI_Mm01_00207656 predicted 1884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266876 predicted 1299
2 SASI_Mm01_00266877 predicted 661
3 SASI_Mm01_00266878 predicted 1613
4 SASI_Mm01_00266879 predicted 1769
5 SASI_Mm01_00266880 predicted 1750
6 SASI_Mm01_00266881 predicted 1509
7 SASI_Mm01_00266882 predicted 633
8 SASI_Mm01_00266883 predicted 1221
9 SASI_Mm01_00266884 predicted 994
10 SASI_Mm01_00266885 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227926 predicted 382
2 SASI_Mm01_00227927 predicted 5453
3 SASI_Mm01_00227928 predicted 3013
4 SASI_Mm01_00227929 predicted 650
5 SASI_Mm01_00227930 predicted 5347
6 SASI_Mm01_00227931 predicted 311
7 SASI_Mm01_00227932 predicted 2657
8 SASI_Mm01_00227933 predicted 2583
9 SASI_Mm01_00227934 predicted 1730
10 SASI_Mm01_00227935 predicted 3151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257284 predicted 383
2 SASI_Mm01_00257285 predicted 5335
3 SASI_Mm01_00257286 predicted 3016
4 SASI_Mm01_00257287 predicted 653
5 SASI_Mm01_00257288 predicted 5225
6 SASI_Mm01_00257289 predicted 306
7 SASI_Mm01_00257290 predicted 2648
8 SASI_Mm01_00257291 predicted 2574
9 SASI_Mm01_00257292 predicted 1733
10 SASI_Mm01_00257293 predicted 3156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126866
KIDINS220 MISSION shRNA Bacterial Glycerol Stock
kinase D-interacting substrate, 220kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-1904s1c1
Sequence:CCGGCCCGGCTGTTTCGAGTATTTACTCGAGTAAATACTCGAAACAGCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-775s1c1
Sequence:CCGGGCCGGAACATACGTGAACATACTCGAGTATGTTCACGTATGTTCCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-4783s1c1
Sequence:CCGGGCGAATCTCATCGAGCTTGAACTCGAGTTCAAGCTCGATGAGATTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-619s1c1
Sequence:CCGGGCACTGATTGTGGCAGTGAAACTCGAGTTTCACTGCCACAATCAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-67s1c1
Sequence:CCGGGCCCTTCTTGAGAAGTGCAAACTCGAGTTTGCACTTCTCAAGAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126866
KIDINS220 MISSION shRNA shRNA Plasmid DNA
kinase D-interacting substrate, 220kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-1904s1c1
Sequence:CCGGCCCGGCTGTTTCGAGTATTTACTCGAGTAAATACTCGAAACAGCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-775s1c1
Sequence:CCGGGCCGGAACATACGTGAACATACTCGAGTATGTTCACGTATGTTCCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-4783s1c1
Sequence:CCGGGCGAATCTCATCGAGCTTGAACTCGAGTTCAAGCTCGATGAGATTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-619s1c1
Sequence:CCGGGCACTGATTGTGGCAGTGAAACTCGAGTTTCACTGCCACAATCAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-67s1c1
Sequence:CCGGGCCCTTCTTGAGAAGTGCAAACTCGAGTTTGCACTTCTCAAGAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126866
KIDINS220 MISSION shRNA Lentiviral Transduction Particles
kinase D-interacting substrate, 220kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-1904s1c1
Sequence:CCGGCCCGGCTGTTTCGAGTATTTACTCGAGTAAATACTCGAAACAGCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-775s1c1
Sequence:CCGGGCCGGAACATACGTGAACATACTCGAGTATGTTCACGTATGTTCCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-4783s1c1
Sequence:CCGGGCGAATCTCATCGAGCTTGAACTCGAGTTCAAGCTCGATGAGATTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-619s1c1
Sequence:CCGGGCACTGATTGTGGCAGTGAAACTCGAGTTTCACTGCCACAATCAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126866.5-67s1c1
Sequence:CCGGGCCCTTCTTGAGAAGTGCAAACTCGAGTTTGCACTTCTCAAGAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081378
KIDINS220 MISSION shRNA Bacterial Glycerol Stock
kinase D-interacting substrate, 220kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000363059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-892s21c1
Sequence:CCGGCGTCGAAGGAGGGACATATAGCTCGAGCTATATGTCCCTCCTTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-1165s21c1
Sequence:CCGGATGGCGAGACACCACTAATAACTCGAGTTATTAGTGGTGTCTCGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-2063s21c1
Sequence:CCGGTACCCGGCTGTTTCGAGTATTCTCGAGAATACTCGAAACAGCCGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-373s21c1
Sequence:CCGGATAACTGGACTGCGCTTATATCTCGAGATATAAGCGCAGTCCAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081378
KIDINS220 MISSION shRNA shRNA Plasmid DNA
kinase D-interacting substrate, 220kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000363059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-892s21c1
Sequence:CCGGCGTCGAAGGAGGGACATATAGCTCGAGCTATATGTCCCTCCTTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-1165s21c1
Sequence:CCGGATGGCGAGACACCACTAATAACTCGAGTTATTAGTGGTGTCTCGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-2063s21c1
Sequence:CCGGTACCCGGCTGTTTCGAGTATTCTCGAGAATACTCGAAACAGCCGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-373s21c1
Sequence:CCGGATAACTGGACTGCGCTTATATCTCGAGATATAAGCGCAGTCCAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081378
KIDINS220 MISSION shRNA Lentiviral Transduction Particles
kinase D-interacting substrate, 220kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000363059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-892s21c1
Sequence:CCGGCGTCGAAGGAGGGACATATAGCTCGAGCTATATGTCCCTCCTTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-1165s21c1
Sequence:CCGGATGGCGAGACACCACTAATAACTCGAGTTATTAGTGGTGTCTCGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-2063s21c1
Sequence:CCGGTACCCGGCTGTTTCGAGTATTCTCGAGAATACTCGAAACAGCCGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081378.1-373s21c1
Sequence:CCGGATAACTGGACTGCGCTTATATCTCGAGATATAAGCGCAGTCCAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291015
VALIDATED
KIDINS220 MISSION shRNA Bacterial Glycerol Stock
kinase D-interacting substrate, 220kDa
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_291015.3-4299s1c1
Sequence:CCGGCCGAGTATAGAGATGCCTATACTCGAGTATAGGCATCTCTATACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_291015.3-3332s1c1
Sequence:CCGGCGGGAAATTATTGCAGATGTTCTCGAGAACATCTGCAATAATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291015.3-4840s1c1
Sequence:CCGGGCCGATCAGAACCTTCATTAACTCGAGTTAATGAAGGTTCTGATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_291015.3-3088s1c1
Sequence:CCGGCCGGACTTCATGGCTCATATTCTCGAGAATATGAGCCATGAAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291015.3-2069s1c1
Sequence:CCGGCGAGTATTCAAGACTGAAGATCTCGAGATCTTCAGTCTTGAATACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291015.3-3332s1c2
Sequence:CCGGCGGGAAATTATTGCAGATGTTCTCGAGAACATCTGCAATAATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291015
VALIDATED
KIDINS220 MISSION shRNA shRNA Plasmid DNA
kinase D-interacting substrate, 220kDa
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_291015.3-4299s1c1
Sequence:CCGGCCGAGTATAGAGATGCCTATACTCGAGTATAGGCATCTCTATACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_291015.3-3332s1c1
Sequence:CCGGCGGGAAATTATTGCAGATGTTCTCGAGAACATCTGCAATAATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291015.3-4840s1c1
Sequence:CCGGGCCGATCAGAACCTTCATTAACTCGAGTTAATGAAGGTTCTGATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_291015.3-3088s1c1
Sequence:CCGGCCGGACTTCATGGCTCATATTCTCGAGAATATGAGCCATGAAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291015.3-2069s1c1
Sequence:CCGGCGAGTATTCAAGACTGAAGATCTCGAGATCTTCAGTCTTGAATACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291015.3-3332s1c2
Sequence:CCGGCGGGAAATTATTGCAGATGTTCTCGAGAACATCTGCAATAATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291015
VALIDATED
KIDINS220 MISSION shRNA Lentiviral Transduction Particles
kinase D-interacting substrate, 220kDa
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_291015.3-4299s1c1
Sequence:CCGGCCGAGTATAGAGATGCCTATACTCGAGTATAGGCATCTCTATACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_291015.3-3332s1c1
Sequence:CCGGCGGGAAATTATTGCAGATGTTCTCGAGAACATCTGCAATAATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291015.3-4840s1c1
Sequence:CCGGGCCGATCAGAACCTTCATTAACTCGAGTTAATGAAGGTTCTGATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_291015.3-3088s1c1
Sequence:CCGGCCGGACTTCATGGCTCATATTCTCGAGAATATGAGCCATGAAGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291015.3-2069s1c1
Sequence:CCGGCGAGTATTCAAGACTGAAGATCTCGAGATCTTCAGTCTTGAATACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291015.3-3332s1c2
Sequence:CCGGCGGGAAATTATTGCAGATGTTCTCGAGAACATCTGCAATAATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020738
VALIDATED
KIDINS220 MISSION shRNA Bacterial Glycerol Stock
kinase D-interacting substrate, 220kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020738.2-4324s21c1
Sequence:CCGGCCGAGTATAGAGATGCCTATACTCGAGTATAGGCATCTCTATACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020738.2-5082s21c1
Sequence:CCGGGGCCTGCAAGATCCAATTATACTCGAGTATAATTGGATCTTGCAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020738.2-5777s21c1
Sequence:CCGGGAGGTGAGATCTGAGTATAAACTCGAGTTTATACTCAGATCTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020738.2-3113s21c1
Sequence:CCGGCCGGACTTCATGGCTCATATTCTCGAGAATATGAGCCATGAAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020738.2-3357s21c1
Sequence:CCGGCGGGAAATTATTGCAGATGTTCTCGAGAACATCTGCAATAATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020738
VALIDATED
KIDINS220 MISSION shRNA shRNA Plasmid DNA
kinase D-interacting substrate, 220kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020738.2-4324s21c1
Sequence:CCGGCCGAGTATAGAGATGCCTATACTCGAGTATAGGCATCTCTATACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020738.2-5082s21c1
Sequence:CCGGGGCCTGCAAGATCCAATTATACTCGAGTATAATTGGATCTTGCAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020738.2-5777s21c1
Sequence:CCGGGAGGTGAGATCTGAGTATAAACTCGAGTTTATACTCAGATCTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020738.2-3113s21c1
Sequence:CCGGCCGGACTTCATGGCTCATATTCTCGAGAATATGAGCCATGAAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020738.2-3357s21c1
Sequence:CCGGCGGGAAATTATTGCAGATGTTCTCGAGAACATCTGCAATAATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020738
VALIDATED
KIDINS220 MISSION shRNA Lentiviral Transduction Particles
kinase D-interacting substrate, 220kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020738.2-4324s21c1
Sequence:CCGGCCGAGTATAGAGATGCCTATACTCGAGTATAGGCATCTCTATACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020738.2-5082s21c1
Sequence:CCGGGGCCTGCAAGATCCAATTATACTCGAGTATAATTGGATCTTGCAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020738.2-5777s21c1
Sequence:CCGGGAGGTGAGATCTGAGTATAAACTCGAGTTTATACTCAGATCTCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020738.2-3113s21c1
Sequence:CCGGCCGGACTTCATGGCTCATATTCTCGAGAATATGAGCCATGAAGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020738.2-3357s21c1
Sequence:CCGGCGGGAAATTATTGCAGATGTTCTCGAGAACATCTGCAATAATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)