EMAIL THIS PAGE TO A FRIEND

KIF11

kinesin family member 11

117 Gene Product Result for
Synonyms: EG5 HKSP KNSL1 MCLMR TRIP5
UniProtKB ID: P52732, A0AV49, B2RMV3, Q15716, Q5VWX0
Gene ID:
Human(3832) Summary: This gene encodes a motor protein that belongs to the kinesin-like protein family. Members of this protein family are known to be involved in various kinds of spindle dynamics. The function of this gene product includes chromosome positioning, centrosome separation and establishing a bipolar spindle during cell mitosis. [provided by RefSeq, Jul 2008]
Mouse(16551) kinesin family member 11
Rat(171304) kinesin family member 11
Zebrafish(195818) kinesin family member 11
dog(477769) kinesin family member 11
domestic cat(101085662) kinesin family member 11
cow(508467) kinesin family member 11
Horse(100061868) kinesin family member 11
chicken(423809) kinesin family member 11
sheep(101102946) kinesin family member 11
Domestic Rabbit(100346135) kinesin family member 11
domestic guinea pig(100724060) kinesin family member 11
naked mole-rat(101707281) kinesin family member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004523 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004523 Rosetta Predictions human pricing
XM_001060913 Rosetta Predictions rat pricing
XM_001080591 Rosetta Predictions rat pricing
XM_215287 Rosetta Predictions rat pricing
NM_010615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161690 predicted 368
2 SASI_Hs01_00161691 predicted 566
3 SASI_Hs01_00161692 predicted 2891
4 SASI_Hs01_00161694 predicted 2933
5 SASI_Hs01_00161695 predicted 2667
6 SASI_Hs01_00161696 predicted 1994
7 SASI_Hs01_00161697 predicted 2112
8 SASI_Hs01_00161698 predicted 704
9 SASI_Hs02_00337816 predicted 2291
10 SASI_Hs01_00161693 predicted 424
11 SASI_Hs01_00161689 positive 751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298137 predicted 654
2 SASI_Rn02_00298138 predicted 2965
3 SASI_Rn02_00298139 predicted 1510
4 SASI_Rn02_00298140 predicted 779
5 SASI_Rn02_00298141 predicted 1732
6 SASI_Rn02_00298142 predicted 1847
7 SASI_Rn02_00298143 predicted 2483
8 SASI_Rn02_00298144 predicted 1289
9 SASI_Rn02_00298145 predicted 986
10 SASI_Rn02_00298146 predicted 2365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368549 predicted 654
2 SASI_Rn02_00368550 predicted 2962
3 SASI_Rn02_00368551 predicted 1505
4 SASI_Rn02_00368552 predicted 780
5 SASI_Rn02_00368553 predicted 1736
6 SASI_Rn02_00368554 predicted 1847
7 SASI_Rn02_00368555 predicted 2475
8 SASI_Rn02_00368556 predicted 1288
9 SASI_Rn02_00368557 predicted 988
10 SASI_Rn02_00368558 predicted 2367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153526 predicted 480
2 SASI_Rn01_00153527 predicted 455
3 SASI_Rn01_00153528 predicted 575
4 SASI_Rn01_00153529 predicted 782
5 SASI_Rn01_00153530 predicted 271
6 SASI_Rn01_00153531 predicted 234
7 SASI_Rn01_00153532 predicted 257
8 SASI_Rn01_00153533 predicted 480
9 SASI_Rn01_00153534 predicted 298
10 SASI_Rn01_00153535 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059896 predicted 1673
2 SASI_Mm01_00059898 predicted 1518
3 SASI_Mm02_00318940 predicted 1258
4 SASI_Mm02_00318941 predicted 622
5 SASI_Mm02_00318942 predicted 1710
6 SASI_Mm02_00318943 predicted 2455
7 SASI_Mm02_00318944 predicted 2017
8 SASI_Mm02_00318945 predicted 754
9 SASI_Mm02_00318946 predicted 2758
10 SASI_Mm02_00318947 predicted 2477
11 SASI_Mm01_00059897 predicted 3404
12 SASI_Mm01_00059899 predicted 1333
13 SASI_Mm01_00059900 predicted 790
14 SASI_Mm01_00059901 predicted 1251
15 SASI_Mm01_00059902 predicted 2390
16 SASI_Mm01_00059903 predicted 1407
17 SASI_Mm01_00059904 predicted 3450
18 SASI_Mm01_00059905 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010615
KIF11 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010615.1-2140s21c1
Sequence:CCGGATAAGCAGCTACAGCATATTTCTCGAGAAATATGCTGTAGCTGCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010615.1-3505s21c1
Sequence:CCGGGTAGTAAGCTGGGTATCATTTCTCGAGAAATGATACCCAGCTTACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010615.1-2452s21c1
Sequence:CCGGAGCTGAGGTCTACTGATATAACTCGAGTTATATCAGTAGACCTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-324s1c1
Sequence:CCGGGCACGGAAAGAAGTCAGTGTACTCGAGTACACTGACTTCTTTCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-2767s1c1
Sequence:CCGGCGGAGATCACTAAGAAAGTAACTCGAGTTACTTTCTTAGTGATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-2508s1c1
Sequence:CCGGGCTGAATCTGATGGATTATTACTCGAGTAATAATCCATCAGATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-865s1c1
Sequence:CCGGCCTTGATGAATGCTTACTCTACTCGAGTAGAGTAAGCATTCATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010615.1-1681s21c1
Sequence:CCGGAGTTGCTTAACACGGTTAAAGCTCGAGCTTTAACCGTGTTAAGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010615.1-3777s1c1
Sequence:CCGGGCCTACAGAAAGGTTTCTTTACTCGAGTAAAGAAACCTTTCTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010615
KIF11 MISSION shRNA shRNA Plasmid DNA
kinesin family member 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010615.1-2140s21c1
Sequence:CCGGATAAGCAGCTACAGCATATTTCTCGAGAAATATGCTGTAGCTGCTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010615.1-3505s21c1
Sequence:CCGGGTAGTAAGCTGGGTATCATTTCTCGAGAAATGATACCCAGCTTACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010615.1-2452s21c1
Sequence:CCGGAGCTGAGGTCTACTGATATAACTCGAGTTATATCAGTAGACCTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-324s1c1
Sequence:CCGGGCACGGAAAGAAGTCAGTGTACTCGAGTACACTGACTTCTTTCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-2767s1c1
Sequence:CCGGCGGAGATCACTAAGAAAGTAACTCGAGTTACTTTCTTAGTGATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-2508s1c1
Sequence:CCGGGCTGAATCTGATGGATTATTACTCGAGTAATAATCCATCAGATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-865s1c1
Sequence:CCGGCCTTGATGAATGCTTACTCTACTCGAGTAGAGTAAGCATTCATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010615.1-1681s21c1
Sequence:CCGGAGTTGCTTAACACGGTTAAAGCTCGAGCTTTAACCGTGTTAAGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010615.1-3777s1c1
Sequence:CCGGGCCTACAGAAAGGTTTCTTTACTCGAGTAAAGAAACCTTTCTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010615
KIF11 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010615.1-2140s21c1
Sequence:CCGGATAAGCAGCTACAGCATATTTCTCGAGAAATATGCTGTAGCTGCTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010615.1-3505s21c1
Sequence:CCGGGTAGTAAGCTGGGTATCATTTCTCGAGAAATGATACCCAGCTTACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010615.1-2452s21c1
Sequence:CCGGAGCTGAGGTCTACTGATATAACTCGAGTTATATCAGTAGACCTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-324s1c1
Sequence:CCGGGCACGGAAAGAAGTCAGTGTACTCGAGTACACTGACTTCTTTCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-2767s1c1
Sequence:CCGGCGGAGATCACTAAGAAAGTAACTCGAGTTACTTTCTTAGTGATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-2508s1c1
Sequence:CCGGGCTGAATCTGATGGATTATTACTCGAGTAATAATCCATCAGATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010615.1-865s1c1
Sequence:CCGGCCTTGATGAATGCTTACTCTACTCGAGTAGAGTAAGCATTCATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010615.1-1681s21c1
Sequence:CCGGAGTTGCTTAACACGGTTAAAGCTCGAGCTTTAACCGTGTTAAGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010615.1-3777s1c1
Sequence:CCGGGCCTACAGAAAGGTTTCTTTACTCGAGTAAAGAAACCTTTCTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004523
VALIDATED
KIF11 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 11
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-4746s21c1
Sequence:CCGGTTTGATCTGGCAACCATATTTCTCGAGAAATATGGTTGCCAGATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-1445s21c1
Sequence:CCGGGGAGGAGATAGAACGTTTAAACTCGAGTTTAAACGTTCTATCTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-3458s21c1
Sequence:CCGGGCGAGCCCAGATCAACCTTTACTCGAGTAAAGGTTGATCTGGGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-1186s21c1
Sequence:CCGGTGACTTTGGGAAGGGTCATTACTCGAGTAATGACCCTTCCCAAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-1989s21c1
Sequence:CCGGGAAGTACATAAGACCTTATTTCTCGAGAAATAAGGTCTTATGTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-718s21c1
Sequence:CCGGCACGTACCCTTCATCAAATTTCTCGAGAAATTTGATGAAGGGTACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-695s21c1
Sequence:CCGGGGATCCCTTGGCTGGTATAATCTCGAGATTATACCAGCCAAGGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-3263s21c1
Sequence:CCGGGTATACTGAAGAACCTCTAAGCTCGAGCTTAGAGGTTCTTCAGTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004523.3-581s21c1
Sequence:CCGGTGAAGTTATTATGGGCTATAACTCGAGTTATAGCCCATAATAACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004523.2-3927s1c1
Sequence:CCGGGCTTGAGCTTAACATAGGTAACTCGAGTTACCTATGTTAAGCTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004523.2-2134s1c1
Sequence:CCGGCCGATAAGATAGAAGATCAAACTCGAGTTTGATCTTCTATCTTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004523.2-2695s1c1
Sequence:CCGGGCCAATGTTGTGAGGCTTCAACTCGAGTTGAAGCCTCACAACATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004523.2-1118s1c1
Sequence:CCGGGCGTACAAGAACATCTATAATCTCGAGATTATAGATGTTCTTGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004523.2-247s1c1
Sequence:CCGGGCGCCCATTCAATAGTAGAATCTCGAGATTCTACTATTGAATGGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-3979s21c1
Sequence:CCGGTGCAATGTAAATACGTATTTCCTCGAGGAAATACGTATTTACATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004523
VALIDATED
KIF11 MISSION shRNA shRNA Plasmid DNA
kinesin family member 11
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-4746s21c1
Sequence:CCGGTTTGATCTGGCAACCATATTTCTCGAGAAATATGGTTGCCAGATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-1445s21c1
Sequence:CCGGGGAGGAGATAGAACGTTTAAACTCGAGTTTAAACGTTCTATCTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-3458s21c1
Sequence:CCGGGCGAGCCCAGATCAACCTTTACTCGAGTAAAGGTTGATCTGGGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-1186s21c1
Sequence:CCGGTGACTTTGGGAAGGGTCATTACTCGAGTAATGACCCTTCCCAAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-1989s21c1
Sequence:CCGGGAAGTACATAAGACCTTATTTCTCGAGAAATAAGGTCTTATGTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-718s21c1
Sequence:CCGGCACGTACCCTTCATCAAATTTCTCGAGAAATTTGATGAAGGGTACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-695s21c1
Sequence:CCGGGGATCCCTTGGCTGGTATAATCTCGAGATTATACCAGCCAAGGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-3263s21c1
Sequence:CCGGGTATACTGAAGAACCTCTAAGCTCGAGCTTAGAGGTTCTTCAGTATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004523.3-581s21c1
Sequence:CCGGTGAAGTTATTATGGGCTATAACTCGAGTTATAGCCCATAATAACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004523.2-3927s1c1
Sequence:CCGGGCTTGAGCTTAACATAGGTAACTCGAGTTACCTATGTTAAGCTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004523.2-2134s1c1
Sequence:CCGGCCGATAAGATAGAAGATCAAACTCGAGTTTGATCTTCTATCTTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004523.2-2695s1c1
Sequence:CCGGGCCAATGTTGTGAGGCTTCAACTCGAGTTGAAGCCTCACAACATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004523.2-1118s1c1
Sequence:CCGGGCGTACAAGAACATCTATAATCTCGAGATTATAGATGTTCTTGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004523.2-247s1c1
Sequence:CCGGGCGCCCATTCAATAGTAGAATCTCGAGATTCTACTATTGAATGGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-3979s21c1
Sequence:CCGGTGCAATGTAAATACGTATTTCCTCGAGGAAATACGTATTTACATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004523
VALIDATED
KIF11 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 11
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-4746s21c1
Sequence:CCGGTTTGATCTGGCAACCATATTTCTCGAGAAATATGGTTGCCAGATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-1445s21c1
Sequence:CCGGGGAGGAGATAGAACGTTTAAACTCGAGTTTAAACGTTCTATCTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-3458s21c1
Sequence:CCGGGCGAGCCCAGATCAACCTTTACTCGAGTAAAGGTTGATCTGGGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-1186s21c1
Sequence:CCGGTGACTTTGGGAAGGGTCATTACTCGAGTAATGACCCTTCCCAAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-1989s21c1
Sequence:CCGGGAAGTACATAAGACCTTATTTCTCGAGAAATAAGGTCTTATGTACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-718s21c1
Sequence:CCGGCACGTACCCTTCATCAAATTTCTCGAGAAATTTGATGAAGGGTACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-695s21c1
Sequence:CCGGGGATCCCTTGGCTGGTATAATCTCGAGATTATACCAGCCAAGGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-3263s21c1
Sequence:CCGGGTATACTGAAGAACCTCTAAGCTCGAGCTTAGAGGTTCTTCAGTATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004523.3-581s21c1
Sequence:CCGGTGAAGTTATTATGGGCTATAACTCGAGTTATAGCCCATAATAACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004523.2-3927s1c1
Sequence:CCGGGCTTGAGCTTAACATAGGTAACTCGAGTTACCTATGTTAAGCTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004523.2-2134s1c1
Sequence:CCGGCCGATAAGATAGAAGATCAAACTCGAGTTTGATCTTCTATCTTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004523.2-2695s1c1
Sequence:CCGGGCCAATGTTGTGAGGCTTCAACTCGAGTTGAAGCCTCACAACATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004523.2-1118s1c1
Sequence:CCGGGCGTACAAGAACATCTATAATCTCGAGATTATAGATGTTCTTGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004523.2-247s1c1
Sequence:CCGGGCGCCCATTCAATAGTAGAATCTCGAGATTCTACTATTGAATGGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004523.3-3979s21c1
Sequence:CCGGTGCAATGTAAATACGTATTTCCTCGAGGAAATACGTATTTACATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)