EMAIL THIS PAGE TO A FRIEND

KIF13A

kinesin family member 13A

136 Gene Product Result for
Synonyms: RBKIN bA500C11.2
Gene ID:
Human(63971) Summary: This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(16553) kinesin family member 13A
Rat(308173) kinesin family member 13A
Zebrafish(100331282) kinesin family member 13A
cow(534832) kinesin family member 13A
Horse(100066150) kinesin family member 13A
domestic cat(101091021) kinesin family member 13A
dog(610516) kinesin family member 13A
chicken(420832) kinesin family member 13A
sheep(101112010) kinesin family member 13A
domestic guinea pig(100730175) kinesin family member 13A
naked mole-rat(101706012) kinesin family member 13A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022113 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105566 Rosetta Predictions human pricing
NM_001105567 Rosetta Predictions human pricing
NM_001105568 Rosetta Predictions human pricing
NM_022113 Rosetta Predictions human pricing
NM_001107462 Rosetta Predictions rat pricing
NM_010617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324461 predicted 1157
2 SASI_Hs02_00324462 predicted 1634
3 SASI_Hs02_00324463 predicted 730
4 SASI_Hs02_00324464 predicted 1439
5 SASI_Hs02_00324465 predicted 2405
6 SASI_Hs02_00324466 predicted 2885
7 SASI_Hs02_00324467 predicted 3888
8 SASI_Hs02_00324468 predicted 1433
9 SASI_Hs02_00324469 predicted 992
10 SASI_Hs02_00324470 predicted 2775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324471 predicted 1157
2 SASI_Hs02_00324472 predicted 1636
3 SASI_Hs02_00324473 predicted 728
4 SASI_Hs02_00324474 predicted 1435
5 SASI_Hs02_00324475 predicted 2404
6 SASI_Hs02_00324476 predicted 2885
7 SASI_Hs02_00324477 predicted 3853
8 SASI_Hs02_00324478 predicted 1430
9 SASI_Hs02_00324479 predicted 999
10 SASI_Hs02_00324480 predicted 2775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324481 predicted 1158
2 SASI_Hs02_00324482 predicted 1641
3 SASI_Hs02_00324483 predicted 735
4 SASI_Hs02_00324484 predicted 1441
5 SASI_Hs02_00324485 predicted 2405
6 SASI_Hs02_00324486 predicted 2889
7 SASI_Hs02_00324487 predicted 3856
8 SASI_Hs02_00324488 predicted 1436
9 SASI_Hs02_00324489 predicted 994
10 SASI_Hs02_00324490 predicted 2780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046528 predicted 1163
2 SASI_Hs01_00046529 predicted 1635
3 SASI_Hs01_00046530 predicted 731
4 SASI_Hs01_00046531 predicted 1438
5 SASI_Hs01_00046533 predicted 2403
6 SASI_Hs01_00046534 predicted 2893
7 SASI_Hs01_00046536 predicted 3893
8 SASI_Hs02_00355506 predicted 1436
9 SASI_Hs01_00046537 predicted 994
10 SASI_Hs02_00355507 predicted 2781
11 SASI_Hs01_00046532 predicted 510
12 SASI_Hs01_00046535 predicted 2126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229065 predicted 199
2 SASI_Rn02_00229066 predicted 4225
3 SASI_Rn02_00229067 predicted 2572
4 SASI_Rn02_00229068 predicted 741
5 SASI_Rn02_00229069 predicted 4943
6 SASI_Rn02_00229070 predicted 509
7 SASI_Rn02_00229071 predicted 341
8 SASI_Rn02_00229072 predicted 4711
9 SASI_Rn02_00229073 predicted 1428
10 SASI_Rn02_00229074 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107456 predicted 1843
2 SASI_Mm01_00107457 predicted 4895
3 SASI_Mm01_00107458 predicted 2741
4 SASI_Mm02_00318950 predicted 4890
5 SASI_Mm01_00107459 predicted 4041
6 SASI_Mm01_00107460 predicted 539
7 SASI_Mm01_00107461 predicted 519
8 SASI_Mm01_00107462 predicted 989
9 SASI_Mm01_00107463 predicted 2500
10 SASI_Mm01_00107464 predicted 677
11 SASI_Mm01_00107465 predicted 1597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022113
VALIDATED
KIF13A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 13A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022113.4-5465s21c1
Sequence:CCGGTAGAGAATGACCAGGTAATAACTCGAGTTATTACCTGGTCATTCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-868s21c1
Sequence:CCGGGGTAGCGAAAGAGTATCTAAACTCGAGTTTAGATACTCTTTCGCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-251s21c1
Sequence:CCGGGGAAACCTCCCAAGGTATTTGCTCGAGCAAATACCTTGGGAGGTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022113.3-5475s1c1
Sequence:CCGGCCGCAACAACTTGGTAGGAAACTCGAGTTTCCTACCAAGTTGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022113.3-837s1c1
Sequence:CCGGGCAACATTAACAAATCGCTTACTCGAGTAAGCGATTTGTTAATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022113.4-3343s21c1
Sequence:CCGGGGTGATGATATGGATAGTTATCTCGAGATAACTATCCATATCATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022113.4-5757s21c1
Sequence:CCGGTCAGATGGATAAGGATCAATCCTCGAGGATTGATCCTTATCCATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022113.3-3320s1c1
Sequence:CCGGGCACTCATTAAACGACGAGAACTCGAGTTCTCGTCGTTTAATGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022113.3-173s1c1
Sequence:CCGGCCCAAGGTATTTGCCTTTGATCTCGAGATCAAAGGCAAATACCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022113.3-4954s1c1
Sequence:CCGGGCCGTCCTCAAACAAAGAGTTCTCGAGAACTCTTTGTTTGAGGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-3408s21c1
Sequence:CCGGACTCATTAAACGACGAGAATACTCGAGTATTCTCGTCGTTTAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-1478s21c1
Sequence:CCGGTTAACGAACTTCTGGTTTATTCTCGAGAATAAACCAGAAGTTCGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022113
VALIDATED
KIF13A MISSION shRNA shRNA Plasmid DNA
kinesin family member 13A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022113.4-5465s21c1
Sequence:CCGGTAGAGAATGACCAGGTAATAACTCGAGTTATTACCTGGTCATTCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-868s21c1
Sequence:CCGGGGTAGCGAAAGAGTATCTAAACTCGAGTTTAGATACTCTTTCGCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-251s21c1
Sequence:CCGGGGAAACCTCCCAAGGTATTTGCTCGAGCAAATACCTTGGGAGGTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022113.3-5475s1c1
Sequence:CCGGCCGCAACAACTTGGTAGGAAACTCGAGTTTCCTACCAAGTTGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022113.3-837s1c1
Sequence:CCGGGCAACATTAACAAATCGCTTACTCGAGTAAGCGATTTGTTAATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022113.4-3343s21c1
Sequence:CCGGGGTGATGATATGGATAGTTATCTCGAGATAACTATCCATATCATCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022113.4-5757s21c1
Sequence:CCGGTCAGATGGATAAGGATCAATCCTCGAGGATTGATCCTTATCCATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022113.3-3320s1c1
Sequence:CCGGGCACTCATTAAACGACGAGAACTCGAGTTCTCGTCGTTTAATGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022113.3-173s1c1
Sequence:CCGGCCCAAGGTATTTGCCTTTGATCTCGAGATCAAAGGCAAATACCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022113.3-4954s1c1
Sequence:CCGGGCCGTCCTCAAACAAAGAGTTCTCGAGAACTCTTTGTTTGAGGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-3408s21c1
Sequence:CCGGACTCATTAAACGACGAGAATACTCGAGTATTCTCGTCGTTTAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-1478s21c1
Sequence:CCGGTTAACGAACTTCTGGTTTATTCTCGAGAATAAACCAGAAGTTCGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022113
VALIDATED
KIF13A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 13A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022113.4-5465s21c1
Sequence:CCGGTAGAGAATGACCAGGTAATAACTCGAGTTATTACCTGGTCATTCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-868s21c1
Sequence:CCGGGGTAGCGAAAGAGTATCTAAACTCGAGTTTAGATACTCTTTCGCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-251s21c1
Sequence:CCGGGGAAACCTCCCAAGGTATTTGCTCGAGCAAATACCTTGGGAGGTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022113.3-5475s1c1
Sequence:CCGGCCGCAACAACTTGGTAGGAAACTCGAGTTTCCTACCAAGTTGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022113.3-837s1c1
Sequence:CCGGGCAACATTAACAAATCGCTTACTCGAGTAAGCGATTTGTTAATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022113.4-3343s21c1
Sequence:CCGGGGTGATGATATGGATAGTTATCTCGAGATAACTATCCATATCATCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022113.4-5757s21c1
Sequence:CCGGTCAGATGGATAAGGATCAATCCTCGAGGATTGATCCTTATCCATCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022113.3-3320s1c1
Sequence:CCGGGCACTCATTAAACGACGAGAACTCGAGTTCTCGTCGTTTAATGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022113.3-173s1c1
Sequence:CCGGCCCAAGGTATTTGCCTTTGATCTCGAGATCAAAGGCAAATACCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022113.3-4954s1c1
Sequence:CCGGGCCGTCCTCAAACAAAGAGTTCTCGAGAACTCTTTGTTTGAGGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-3408s21c1
Sequence:CCGGACTCATTAAACGACGAGAATACTCGAGTATTCTCGTCGTTTAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022113.4-1478s21c1
Sequence:CCGGTTAACGAACTTCTGGTTTATTCTCGAGAATAAACCAGAAGTTCGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010617
KIF13A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 13A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-4580s1c1
Sequence:CCGGGCTGATGCTTACACAGCCTTACTCGAGTAAGGCTGTGTAAGCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010617.1-5850s1c1
Sequence:CCGGGCAGATGAGAAGCATATCTTACTCGAGTAAGATATGCTTCTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-1743s1c1
Sequence:CCGGCGGGACTGGTTGAAAGACTTTCTCGAGAAAGTCTTTCAACCAGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-3360s1c1
Sequence:CCGGGCACTCATTAAACGACGGGAACTCGAGTTCCCGTCGTTTAATGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-3902s1c1
Sequence:CCGGGCAGAGTTTCACCCAGAGTTTCTCGAGAAACTCTGGGTGAAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010617
KIF13A MISSION shRNA shRNA Plasmid DNA
kinesin family member 13A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-4580s1c1
Sequence:CCGGGCTGATGCTTACACAGCCTTACTCGAGTAAGGCTGTGTAAGCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010617.1-5850s1c1
Sequence:CCGGGCAGATGAGAAGCATATCTTACTCGAGTAAGATATGCTTCTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-1743s1c1
Sequence:CCGGCGGGACTGGTTGAAAGACTTTCTCGAGAAAGTCTTTCAACCAGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-3360s1c1
Sequence:CCGGGCACTCATTAAACGACGGGAACTCGAGTTCCCGTCGTTTAATGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-3902s1c1
Sequence:CCGGGCAGAGTTTCACCCAGAGTTTCTCGAGAAACTCTGGGTGAAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010617
KIF13A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 13A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-4580s1c1
Sequence:CCGGGCTGATGCTTACACAGCCTTACTCGAGTAAGGCTGTGTAAGCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010617.1-5850s1c1
Sequence:CCGGGCAGATGAGAAGCATATCTTACTCGAGTAAGATATGCTTCTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-1743s1c1
Sequence:CCGGCGGGACTGGTTGAAAGACTTTCTCGAGAAAGTCTTTCAACCAGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-3360s1c1
Sequence:CCGGGCACTCATTAAACGACGGGAACTCGAGTTCCCGTCGTTTAATGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010617.1-3902s1c1
Sequence:CCGGGCAGAGTTTCACCCAGAGTTTCTCGAGAAACTCTGGGTGAAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)