EMAIL THIS PAGE TO A FRIEND

KIF13B

kinesin family member 13B

82 Gene Product Result for
Synonyms: GAKIN
UniProtKB ID: Q9NQT8, F8VPJ2, O75134, Q9BYJ6
Gene ID:
Mouse(16554) kinesin family member 13B
Rat(305967) kinesin family member 13B
domestic guinea pig(100719289) kinesin family member 13B
naked mole-rat(101701001) kinesin family member 13B
sheep(101109076) kinesin family member 13B
Domestic Rabbit(100338801) kinesin family member 13B
chicken(422026) kinesin family member 13B
cow(534909) kinesin family member 13B
Horse(100061641) kinesin family member 13B
domestic cat(101081799) kinesin family member 13B
dog(477369) kinesin family member 13B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_283218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015254 Rosetta Predictions human pricing
NM_213626 Rosetta Predictions rat pricing
NM_001081177 Rosetta Predictions mouse pricing
XM_283218 Rosetta Predictions mouse pricing
XM_894888 Rosetta Predictions mouse pricing
XM_902031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185692 predicted 3860
2 SASI_Hs01_00185693 predicted 4382
3 SASI_Hs02_00347391 predicted 3607
4 SASI_Hs01_00185694 predicted 746
5 SASI_Hs02_00347392 predicted 1876
6 SASI_Hs01_00185697 predicted 3216
7 SASI_Hs01_00185698 predicted 2849
8 SASI_Hs01_00185699 predicted 2463
9 SASI_Hs01_00185700 predicted 2119
10 SASI_Hs01_00185701 predicted 2297
11 SASI_Hs01_00185695 predicted 1931
12 SASI_Hs01_00185696 predicted 4267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075500 predicted 2756
2 SASI_Rn02_00270617 predicted 2029
3 SASI_Rn01_00075502 predicted 3496
4 SASI_Rn01_00075503 predicted 3794
5 SASI_Rn01_00075504 predicted 1078
6 SASI_Rn01_00075505 predicted 758
7 SASI_Rn01_00075506 predicted 4852
8 SASI_Rn01_00075507 predicted 1291
9 SASI_Rn01_00075508 predicted 2894
10 SASI_Rn01_00075509 predicted 3165
11 SASI_Rn01_00075501 predicted 2021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295941 predicted 5258
2 SASI_Mm02_00295942 predicted 2432
3 SASI_Mm02_00295943 predicted 2827
4 SASI_Mm02_00295944 predicted 1361
5 SASI_Mm02_00295945 predicted 350
6 SASI_Mm02_00295946 predicted 4073
7 SASI_Mm02_00295947 predicted 5270
8 SASI_Mm02_00295948 predicted 515
9 SASI_Mm02_00295949 predicted 3572
10 SASI_Mm02_00295950 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281312 predicted 5269
2 SASI_Mm01_00281313 predicted 2879
3 SASI_Mm01_00281314 predicted 2107
4 SASI_Mm01_00281315 predicted 2835
5 SASI_Mm01_00281316 predicted 2092
6 SASI_Mm01_00281317 predicted 1371
7 SASI_Mm01_00281318 predicted 349
8 SASI_Mm01_00281319 predicted 4080
9 SASI_Mm01_00281320 predicted 5274
10 SASI_Mm01_00281321 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281959 predicted 5030
2 SASI_Mm01_00281960 predicted 2877
3 SASI_Mm01_00281961 predicted 2108
4 SASI_Mm01_00281962 predicted 2833
5 SASI_Mm01_00281963 predicted 2095
6 SASI_Mm01_00281964 predicted 1373
7 SASI_Mm01_00281965 predicted 351
8 SASI_Mm01_00281966 predicted 4082
9 SASI_Mm01_00281967 predicted 5043
10 SASI_Mm01_00281968 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268092 predicted 1338
2 SASI_Mm01_00268093 predicted 687
3 SASI_Mm01_00268094 predicted 722
4 SASI_Mm01_00268095 predicted 1348
5 SASI_Mm01_00268096 predicted 1338
6 SASI_Mm01_00268097 predicted 1118
7 SASI_Mm01_00268098 predicted 807
8 SASI_Mm01_00268099 predicted 605
9 SASI_Mm01_00268100 predicted 1333
10 SASI_Mm01_00268101 predicted 869
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015254
VALIDATED
KIF13B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 13B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-5507s21c1
Sequence:CCGGGAACCCTGAGAACCGGAAATCCTCGAGGATTTCCGGTTCTCAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-1872s21c1
Sequence:CCGGGATCCGATGCAGTCCATATTACTCGAGTAATATGGACTGCATCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-4421s21c1
Sequence:CCGGCAAATCCTTCGTGCCGCAAATCTCGAGATTTGCGGCACGAAGGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-599s21c1
Sequence:CCGGACCTTATGTCGACGGACTTTCCTCGAGGAAAGTCCGTCGACATAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015254.3-5865s21c1
Sequence:CCGGATGTTGCTCTTTCTATCATTTCTCGAGAAATGATAGAAAGAGCAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-5930s1c1
Sequence:CCGGCCCACTAATGTCTTAACCTAACTCGAGTTAGGTTAAGACATTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015254.2-2421s1c1
Sequence:CCGGCCCAGTAATACGATCATACTTCTCGAGAAGTATGATCGTATTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-4663s1c1
Sequence:CCGGGCCTTGAAGATCTGCGACAAACTCGAGTTTGTCGCAGATCTTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-1769s1c1
Sequence:CCGGCCTCCATGAAGAACGAGAATACTCGAGTATTCTCGTTCTTCATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-247s1c1
Sequence:CCGGCCGAAGGTGTTTGCTTATGATCTCGAGATCATAAGCAAACACCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015254
VALIDATED
KIF13B MISSION shRNA shRNA Plasmid DNA
kinesin family member 13B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-5507s21c1
Sequence:CCGGGAACCCTGAGAACCGGAAATCCTCGAGGATTTCCGGTTCTCAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-1872s21c1
Sequence:CCGGGATCCGATGCAGTCCATATTACTCGAGTAATATGGACTGCATCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-4421s21c1
Sequence:CCGGCAAATCCTTCGTGCCGCAAATCTCGAGATTTGCGGCACGAAGGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-599s21c1
Sequence:CCGGACCTTATGTCGACGGACTTTCCTCGAGGAAAGTCCGTCGACATAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015254.3-5865s21c1
Sequence:CCGGATGTTGCTCTTTCTATCATTTCTCGAGAAATGATAGAAAGAGCAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-5930s1c1
Sequence:CCGGCCCACTAATGTCTTAACCTAACTCGAGTTAGGTTAAGACATTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015254.2-2421s1c1
Sequence:CCGGCCCAGTAATACGATCATACTTCTCGAGAAGTATGATCGTATTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-4663s1c1
Sequence:CCGGGCCTTGAAGATCTGCGACAAACTCGAGTTTGTCGCAGATCTTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-1769s1c1
Sequence:CCGGCCTCCATGAAGAACGAGAATACTCGAGTATTCTCGTTCTTCATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-247s1c1
Sequence:CCGGCCGAAGGTGTTTGCTTATGATCTCGAGATCATAAGCAAACACCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015254
VALIDATED
KIF13B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 13B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-5507s21c1
Sequence:CCGGGAACCCTGAGAACCGGAAATCCTCGAGGATTTCCGGTTCTCAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-1872s21c1
Sequence:CCGGGATCCGATGCAGTCCATATTACTCGAGTAATATGGACTGCATCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-4421s21c1
Sequence:CCGGCAAATCCTTCGTGCCGCAAATCTCGAGATTTGCGGCACGAAGGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015254.3-599s21c1
Sequence:CCGGACCTTATGTCGACGGACTTTCCTCGAGGAAAGTCCGTCGACATAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015254.3-5865s21c1
Sequence:CCGGATGTTGCTCTTTCTATCATTTCTCGAGAAATGATAGAAAGAGCAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-5930s1c1
Sequence:CCGGCCCACTAATGTCTTAACCTAACTCGAGTTAGGTTAAGACATTAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015254.2-2421s1c1
Sequence:CCGGCCCAGTAATACGATCATACTTCTCGAGAAGTATGATCGTATTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-4663s1c1
Sequence:CCGGGCCTTGAAGATCTGCGACAAACTCGAGTTTGTCGCAGATCTTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-1769s1c1
Sequence:CCGGCCTCCATGAAGAACGAGAATACTCGAGTATTCTCGTTCTTCATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015254.2-247s1c1
Sequence:CCGGCCGAAGGTGTTTGCTTATGATCTCGAGATCATAAGCAAACACCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283218
KIF13B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 13B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283218.4-7692s1c1
Sequence:CCGGCCTCTGAAAGTAATACCATTTCTCGAGAAATGGTATTACTTTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-3088s1c1
Sequence:CCGGCGGTGGAAGTAATTGCTGCAACTCGAGTTGCAGCAATTACTTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-1257s1c1
Sequence:CCGGCGTCTGGAAGAATCGGAGAAACTCGAGTTTCTCCGATTCTTCCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-3375s1c1
Sequence:CCGGCGTCAAGAATACTTGGATCAACTCGAGTTGATCCAAGTATTCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-120s1c1
Sequence:CCGGCGACGAGAAATTGACTTACATCTCGAGATGTAAGTCAATTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283218
KIF13B MISSION shRNA shRNA Plasmid DNA
kinesin family member 13B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283218.4-7692s1c1
Sequence:CCGGCCTCTGAAAGTAATACCATTTCTCGAGAAATGGTATTACTTTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-3088s1c1
Sequence:CCGGCGGTGGAAGTAATTGCTGCAACTCGAGTTGCAGCAATTACTTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-1257s1c1
Sequence:CCGGCGTCTGGAAGAATCGGAGAAACTCGAGTTTCTCCGATTCTTCCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-3375s1c1
Sequence:CCGGCGTCAAGAATACTTGGATCAACTCGAGTTGATCCAAGTATTCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-120s1c1
Sequence:CCGGCGACGAGAAATTGACTTACATCTCGAGATGTAAGTCAATTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283218
KIF13B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 13B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283218.4-7692s1c1
Sequence:CCGGCCTCTGAAAGTAATACCATTTCTCGAGAAATGGTATTACTTTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-3088s1c1
Sequence:CCGGCGGTGGAAGTAATTGCTGCAACTCGAGTTGCAGCAATTACTTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-1257s1c1
Sequence:CCGGCGTCTGGAAGAATCGGAGAAACTCGAGTTTCTCCGATTCTTCCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-3375s1c1
Sequence:CCGGCGTCAAGAATACTTGGATCAACTCGAGTTGATCCAAGTATTCTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283218.4-120s1c1
Sequence:CCGGCGACGAGAAATTGACTTACATCTCGAGATGTAAGTCAATTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)