EMAIL THIS PAGE TO A FRIEND

KIF14

kinesin family member 14

82 Gene Product Result for
UniProtKB ID: Q15058, Q14CI8, Q4G0A5, Q5T1W3
Gene ID:
Human(9928) Summary: KIF14 is a member of the kinesin superfamily of microtubule-associated motors (see MIM 148760) that play important roles in intracellular transport and cell division (Nakagawa et al., 1997 [PubMed 9275178]
Mouse(381293) kinesin family member 14
Rat(360849) kinesin family member 14
Zebrafish(562052) kinesin family member 14
dog(490248) kinesin family member 14
chicken(424347) kinesin family member 14
domestic cat(101094726) kinesin family member 14
sheep(101107720) kinesin family member 14
Domestic Rabbit(100358026) kinesin family member 14
domestic guinea pig(100735852) kinesin family member 14
naked mole-rat(101701083) kinesin family member 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_619672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_619672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_619672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014875 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014875 Rosetta Predictions human pricing
NM_001108345 Rosetta Predictions rat pricing
NM_001081258 Rosetta Predictions mouse pricing
XM_619672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346479 predicted 3524
2 SASI_Hs01_00015036 predicted 2224
3 SASI_Hs01_00015037 predicted 5256
4 SASI_Hs01_00015038 predicted 4051
5 SASI_Hs01_00015040 predicted 4808
6 SASI_Hs02_00346480 predicted 5273
7 SASI_Hs02_00346481 predicted 4393
8 SASI_Hs01_00015042 predicted 1152
9 SASI_Hs02_00346482 predicted 4172
10 SASI_Hs01_00015044 predicted 2516
11 SASI_Hs01_00015039 predicted 1619
12 SASI_Hs01_00015041 predicted 5241
13 SASI_Hs01_00015043 predicted 3695
14 SASI_Hs01_00015045 predicted 2053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237749 predicted 1064
2 SASI_Rn02_00237750 predicted 641
3 SASI_Rn02_00237751 predicted 592
4 SASI_Rn02_00237752 predicted 1010
5 SASI_Rn02_00237753 predicted 614
6 SASI_Rn02_00237754 predicted 283
7 SASI_Rn02_00237755 predicted 288
8 SASI_Rn02_00237756 predicted 1718
9 SASI_Rn02_00237757 predicted 797
10 SASI_Rn02_00237758 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296717 predicted 1127
2 SASI_Mm02_00296718 predicted 3626
3 SASI_Mm02_00296719 predicted 3960
4 SASI_Mm02_00296720 predicted 4208
5 SASI_Mm02_00296721 predicted 2043
6 SASI_Mm02_00296722 predicted 2351
7 SASI_Mm02_00296723 predicted 4191
8 SASI_Mm02_00296724 predicted 2237
9 SASI_Mm02_00296725 predicted 3096
10 SASI_Mm02_00296726 predicted 4414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271648 predicted 1132
2 SASI_Mm01_00271649 predicted 3971
3 SASI_Mm01_00271650 predicted 4215
4 SASI_Mm01_00271651 predicted 2049
5 SASI_Mm01_00271652 predicted 2355
6 SASI_Mm01_00271653 predicted 2248
7 SASI_Mm01_00271654 predicted 3100
8 SASI_Mm01_00271655 predicted 4956
9 SASI_Mm01_00271656 predicted 4427
10 SASI_Mm01_00271657 predicted 2489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_619672
KIF14 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_619672.1-2597s1c1
Sequence:CCGGCCTCTGTGTATGCTCAGAATTCTCGAGAATTCTGAGCATACACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-2400s1c1
Sequence:CCGGCCGAATAGGATTCAGTGGGTACTCGAGTACCCACTGAATCCTATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-1297s1c1
Sequence:CCGGGCCTGATAAATAATCTCCTTACTCGAGTAAGGAGATTATTTATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-948s1c1
Sequence:CCGGGCAGCAATGAAAGAGCTTTATCTCGAGATAAAGCTCTTTCATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-1591s1c1
Sequence:CCGGCGATGGTTAAAGAGGCTCAAACTCGAGTTTGAGCCTCTTTAACCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_619672
KIF14 MISSION shRNA shRNA Plasmid DNA
kinesin family member 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_619672.1-2597s1c1
Sequence:CCGGCCTCTGTGTATGCTCAGAATTCTCGAGAATTCTGAGCATACACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-2400s1c1
Sequence:CCGGCCGAATAGGATTCAGTGGGTACTCGAGTACCCACTGAATCCTATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-1297s1c1
Sequence:CCGGGCCTGATAAATAATCTCCTTACTCGAGTAAGGAGATTATTTATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-948s1c1
Sequence:CCGGGCAGCAATGAAAGAGCTTTATCTCGAGATAAAGCTCTTTCATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-1591s1c1
Sequence:CCGGCGATGGTTAAAGAGGCTCAAACTCGAGTTTGAGCCTCTTTAACCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_619672
KIF14 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_619672.1-2597s1c1
Sequence:CCGGCCTCTGTGTATGCTCAGAATTCTCGAGAATTCTGAGCATACACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-2400s1c1
Sequence:CCGGCCGAATAGGATTCAGTGGGTACTCGAGTACCCACTGAATCCTATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-1297s1c1
Sequence:CCGGGCCTGATAAATAATCTCCTTACTCGAGTAAGGAGATTATTTATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-948s1c1
Sequence:CCGGGCAGCAATGAAAGAGCTTTATCTCGAGATAAAGCTCTTTCATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619672.1-1591s1c1
Sequence:CCGGCGATGGTTAAAGAGGCTCAAACTCGAGTTTGAGCCTCTTTAACCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014875
VALIDATED
KIF14 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 14
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-6210s1c1
Sequence:CCGGCCCTGTTATCTGTGTTTCATACTCGAGTATGAAACACAGATAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014875.1-2531s1c1
Sequence:CCGGGCCCGTTTAATAGTCAACATTCTCGAGAATGTTGACTATTAAACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-3520s1c1
Sequence:CCGGGCGATTAGAAATGGAGACATTCTCGAGAATGTCTCCATTTCTAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-550s1c1
Sequence:CCGGGCTGCATTTGAAGTCGGATATCTCGAGATATCCGACTTCAAATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-2672s1c1
Sequence:CCGGCGGCAAGAAATAACATCCTTACTCGAGTAAGGATGTTATTTCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014875
VALIDATED
KIF14 MISSION shRNA shRNA Plasmid DNA
kinesin family member 14
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-6210s1c1
Sequence:CCGGCCCTGTTATCTGTGTTTCATACTCGAGTATGAAACACAGATAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014875.1-2531s1c1
Sequence:CCGGGCCCGTTTAATAGTCAACATTCTCGAGAATGTTGACTATTAAACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-3520s1c1
Sequence:CCGGGCGATTAGAAATGGAGACATTCTCGAGAATGTCTCCATTTCTAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-550s1c1
Sequence:CCGGGCTGCATTTGAAGTCGGATATCTCGAGATATCCGACTTCAAATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-2672s1c1
Sequence:CCGGCGGCAAGAAATAACATCCTTACTCGAGTAAGGATGTTATTTCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014875
VALIDATED
KIF14 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 14
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-6210s1c1
Sequence:CCGGCCCTGTTATCTGTGTTTCATACTCGAGTATGAAACACAGATAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014875.1-2531s1c1
Sequence:CCGGGCCCGTTTAATAGTCAACATTCTCGAGAATGTTGACTATTAAACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-3520s1c1
Sequence:CCGGGCGATTAGAAATGGAGACATTCTCGAGAATGTCTCCATTTCTAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-550s1c1
Sequence:CCGGGCTGCATTTGAAGTCGGATATCTCGAGATATCCGACTTCAAATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014875.1-2672s1c1
Sequence:CCGGCGGCAAGAAATAACATCCTTACTCGAGTAAGGATGTTATTTCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)