EMAIL THIS PAGE TO A FRIEND

KIF15

kinesin family member 15

56 Gene Product Result for
Synonyms: HKLP2 KNSL7 NY-BR-62
UniProtKB ID: Q9NS87, Q17RV9, Q69YL6, Q96JX7, Q9H280
Gene ID:
Mouse(209737) kinesin family member 15
Rat(353302) kinesin family member 15
domestic guinea pig(100716108) kinesin family member 15
naked mole-rat(101705312) kinesin family member 15
sheep(101121554) kinesin family member 15
Domestic Rabbit(100337803) kinesin family member 15
Zebrafish(573988) kinesin family member 15
chicken(420708) kinesin family member 15
domestic cat(101080949) kinesin family member 15
Horse(100054690) kinesin family member 15
cow(541135) kinesin family member 15
dog(476656) kinesin family member 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020242 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020242 Rosetta Predictions human pricing
NM_181635 Rosetta Predictions rat pricing
NM_010620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201067 predicted 2112
2 SASI_Hs01_00201069 predicted 2664
3 SASI_Hs01_00201070 predicted 3243
4 SASI_Hs01_00201071 predicted 3562
5 SASI_Hs01_00201072 predicted 1298
6 SASI_Hs02_00353196 predicted 3569
7 SASI_Hs01_00201073 predicted 2941
8 SASI_Hs02_00353197 predicted 782
9 SASI_Hs01_00201074 predicted 274
10 SASI_Hs01_00201076 predicted 2068
11 SASI_Hs01_00201068 predicted 4335
12 SASI_Hs01_00201075 predicted 2525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043515 predicted 2013
2 SASI_Rn01_00043516 predicted 1254
3 SASI_Rn01_00043518 predicted 1643
4 SASI_Rn01_00043519 predicted 3935
5 SASI_Rn01_00043520 predicted 3152
6 SASI_Rn01_00043521 predicted 2091
7 SASI_Rn02_00269775 predicted 2262
8 SASI_Rn01_00043522 predicted 3822
9 SASI_Rn02_00269776 predicted 1185
10 SASI_Rn02_00269777 predicted 809
11 SASI_Rn01_00043514 predicted 866
12 SASI_Rn01_00043517 predicted 1193
13 SASI_Rn01_00043523 predicted 2640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318951 predicted 4102
2 SASI_Mm02_00318952 predicted 3542
3 SASI_Mm02_00318953 predicted 344
4 SASI_Mm02_00318954 predicted 1241
5 SASI_Mm02_00318955 predicted 2826
6 SASI_Mm02_00318956 predicted 1803
7 SASI_Mm02_00318957 predicted 840
8 SASI_Mm02_00318958 predicted 3024
9 SASI_Mm02_00318959 predicted 1655
10 SASI_Mm02_00318960 predicted 3012
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010620
KIF15 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-621s1c1
Sequence:CCGGCACATAAAGAAGGGAGTCTTTCTCGAGAAAGACTCCCTTCTTTATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-2787s1c1
Sequence:CCGGCGCAACAACAAATTGTCATTACTCGAGTAATGACAATTTGTTGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-620s1c1
Sequence:CCGGGCACATAAAGAAGGGAGTCTTCTCGAGAAGACTCCCTTCTTTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-2418s1c1
Sequence:CCGGGCTCAGACTAAGAATGAGTTTCTCGAGAAACTCATTCTTAGTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010620.1-4222s1c1
Sequence:CCGGCCCAGCTATCTTCATACACATCTCGAGATGTGTATGAAGATAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010620
KIF15 MISSION shRNA shRNA Plasmid DNA
kinesin family member 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-621s1c1
Sequence:CCGGCACATAAAGAAGGGAGTCTTTCTCGAGAAAGACTCCCTTCTTTATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-2787s1c1
Sequence:CCGGCGCAACAACAAATTGTCATTACTCGAGTAATGACAATTTGTTGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-620s1c1
Sequence:CCGGGCACATAAAGAAGGGAGTCTTCTCGAGAAGACTCCCTTCTTTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-2418s1c1
Sequence:CCGGGCTCAGACTAAGAATGAGTTTCTCGAGAAACTCATTCTTAGTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010620.1-4222s1c1
Sequence:CCGGCCCAGCTATCTTCATACACATCTCGAGATGTGTATGAAGATAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010620
KIF15 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-621s1c1
Sequence:CCGGCACATAAAGAAGGGAGTCTTTCTCGAGAAAGACTCCCTTCTTTATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-2787s1c1
Sequence:CCGGCGCAACAACAAATTGTCATTACTCGAGTAATGACAATTTGTTGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-620s1c1
Sequence:CCGGGCACATAAAGAAGGGAGTCTTCTCGAGAAGACTCCCTTCTTTATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010620.1-2418s1c1
Sequence:CCGGGCTCAGACTAAGAATGAGTTTCTCGAGAAACTCATTCTTAGTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010620.1-4222s1c1
Sequence:CCGGCCCAGCTATCTTCATACACATCTCGAGATGTGTATGAAGATAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020242
KIF15 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-2124s1c1
Sequence:CCGGGCTCTCTATACACTCAGAATTCTCGAGAATTCTGAGTGTATAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-1217s1c1
Sequence:CCGGGCTGAAGTGAAGAGGCTCAAACTCGAGTTTGAGCCTCTTCACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-105s1c1
Sequence:CCGGGCGTGACAAATGGTCAGTCTACTCGAGTAGACTGACCATTTGTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-106s1c1
Sequence:CCGGCGTGACAAATGGTCAGTCTAACTCGAGTTAGACTGACCATTTGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020242.1-4329s1c1
Sequence:CCGGGCTGAATTTATGGACCTTAATCTCGAGATTAAGGTCCATAAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020242.2-537s21c1
Sequence:CCGGCATAACCTGAGAGGAGTAATCCTCGAGGATTACTCCTCTCAGGTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020242.2-434s21c1
Sequence:CCGGGTCTTGCATGAGCGGTTATAACTCGAGTTATAACCGCTCATGCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020242.2-1221s21c1
Sequence:CCGGCAAAGAGCCAAGCTGATTAAACTCGAGTTTAATCAGCTTGGCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020242
KIF15 MISSION shRNA shRNA Plasmid DNA
kinesin family member 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-2124s1c1
Sequence:CCGGGCTCTCTATACACTCAGAATTCTCGAGAATTCTGAGTGTATAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-1217s1c1
Sequence:CCGGGCTGAAGTGAAGAGGCTCAAACTCGAGTTTGAGCCTCTTCACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-105s1c1
Sequence:CCGGGCGTGACAAATGGTCAGTCTACTCGAGTAGACTGACCATTTGTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-106s1c1
Sequence:CCGGCGTGACAAATGGTCAGTCTAACTCGAGTTAGACTGACCATTTGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020242.1-4329s1c1
Sequence:CCGGGCTGAATTTATGGACCTTAATCTCGAGATTAAGGTCCATAAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020242.2-537s21c1
Sequence:CCGGCATAACCTGAGAGGAGTAATCCTCGAGGATTACTCCTCTCAGGTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020242.2-434s21c1
Sequence:CCGGGTCTTGCATGAGCGGTTATAACTCGAGTTATAACCGCTCATGCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020242.2-1221s21c1
Sequence:CCGGCAAAGAGCCAAGCTGATTAAACTCGAGTTTAATCAGCTTGGCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020242
KIF15 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-2124s1c1
Sequence:CCGGGCTCTCTATACACTCAGAATTCTCGAGAATTCTGAGTGTATAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-1217s1c1
Sequence:CCGGGCTGAAGTGAAGAGGCTCAAACTCGAGTTTGAGCCTCTTCACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-105s1c1
Sequence:CCGGGCGTGACAAATGGTCAGTCTACTCGAGTAGACTGACCATTTGTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020242.1-106s1c1
Sequence:CCGGCGTGACAAATGGTCAGTCTAACTCGAGTTAGACTGACCATTTGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020242.1-4329s1c1
Sequence:CCGGGCTGAATTTATGGACCTTAATCTCGAGATTAAGGTCCATAAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020242.2-537s21c1
Sequence:CCGGCATAACCTGAGAGGAGTAATCCTCGAGGATTACTCCTCTCAGGTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020242.2-434s21c1
Sequence:CCGGGTCTTGCATGAGCGGTTATAACTCGAGTTATAACCGCTCATGCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020242.2-1221s21c1
Sequence:CCGGCAAAGAGCCAAGCTGATTAAACTCGAGTTTAATCAGCTTGGCTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)