EMAIL THIS PAGE TO A FRIEND

KIF16B

kinesin family member 16B

150 Gene Product Result for
Synonyms: C20orf23 KISC20ORF SNX23
Gene ID:
Human(55614) Summary: The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(16558) kinesin family member 16B
Rat(311478) kinesin family member 16B
chicken(421260) kinesin family member 16B
dog(485759) kinesin family member 16B
Horse(100050906) kinesin family member 16B
cow(532276) kinesin family member 16B
domestic cat(101096718) kinesin family member 16B
sheep(101111986) kinesin family member 16B
Domestic Rabbit(100347891) kinesin family member 16B
naked mole-rat(101707293) kinesin family member 16B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024704 Rosetta Predictions human pricing
NM_001107783 Rosetta Predictions rat pricing
NM_001081133 Rosetta Predictions mouse pricing
XM_141392 Rosetta Predictions mouse pricing
XM_902260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074963 predicted 512
2 SASI_Hs02_00357161 predicted 1223
3 SASI_Hs01_00074964 predicted 600
4 SASI_Hs01_00074965 predicted 688
5 SASI_Hs01_00074966 predicted 1788
6 SASI_Hs01_00074967 predicted 748
7 SASI_Hs01_00074968 predicted 2618
8 SASI_Hs01_00074969 predicted 2848
9 SASI_Hs01_00074970 predicted 2156
10 SASI_Hs01_00074971 predicted 1325
11 SASI_Hs01_00074972 predicted 2971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232225 predicted 1940
2 SASI_Rn02_00232226 predicted 255
3 SASI_Rn02_00232227 predicted 1081
4 SASI_Rn02_00232228 predicted 3813
5 SASI_Rn02_00232229 predicted 408
6 SASI_Rn02_00232230 predicted 3729
7 SASI_Rn02_00232231 predicted 1646
8 SASI_Rn02_00232232 predicted 1657
9 SASI_Rn02_00232233 predicted 3885
10 SASI_Rn02_00232234 predicted 1781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295511 predicted 3235
2 SASI_Mm02_00295512 predicted 1157
3 SASI_Mm02_00295513 predicted 1263
4 SASI_Mm02_00295514 predicted 2629
5 SASI_Mm02_00295515 predicted 448
6 SASI_Mm02_00295516 predicted 2016
7 SASI_Mm02_00295517 predicted 1985
8 SASI_Mm02_00295518 predicted 1728
9 SASI_Mm02_00295519 predicted 2189
10 SASI_Mm02_00295520 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_141392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221948 predicted 1172
2 SASI_Mm01_00221949 predicted 1265
3 SASI_Mm01_00221950 predicted 2635
4 SASI_Mm01_00221951 predicted 450
5 SASI_Mm01_00221952 predicted 2024
6 SASI_Mm01_00221953 predicted 1744
7 SASI_Mm01_00221954 predicted 1990
8 SASI_Mm01_00221955 predicted 1731
9 SASI_Mm01_00221956 predicted 1821
10 SASI_Mm01_00221957 predicted 3893
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248489 predicted 429
2 SASI_Mm01_00248490 predicted 420
3 SASI_Mm01_00248491 predicted 584
4 SASI_Mm01_00248492 predicted 525
5 SASI_Mm01_00248493 predicted 411
6 SASI_Mm01_00248494 predicted 627
7 SASI_Mm01_00248495 predicted 438
8 SASI_Mm01_00248496 predicted 545
9 SASI_Mm01_00248497 predicted 361
10 SASI_Mm01_00248498 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024704
VALIDATED
KIF16B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 16B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024704.3-878s21c1
Sequence:CCGGGCCATGTGAAACCGTCAGTAACTCGAGTTACTGACGGTTTCACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024704.3-700s21c1
Sequence:CCGGGCCCTTATGTTGAGGATTTATCTCGAGATAAATCCTCAACATAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024704.3-4623s21c1
Sequence:CCGGCCTCATTTGAATCAGAACTTTCTCGAGAAAGTTCTGATTCAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024704.3-3628s21c1
Sequence:CCGGGCACCATTCAACGTAAACTAACTCGAGTTAGTTTACGTTGAATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-4623s1c1
Sequence:CCGGCCTCATTTGAATCAGAACTTTCTCGAGAAAGTTCTGATTCAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-700s1c1
Sequence:CCGGGCCCTTATGTTGAGGATTTATCTCGAGATAAATCCTCAACATAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-3628s1c1
Sequence:CCGGGCACCATTCAACGTAAACTAACTCGAGTTAGTTTACGTTGAATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-878s1c1
Sequence:CCGGGCCATGTGAAACCGTCAGTAACTCGAGTTACTGACGGTTTCACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024704.3-1206s1c1
Sequence:CCGGCGCTATGCAAATAGAGCCAAACTCGAGTTTGGCTCTATTTGCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024704
VALIDATED
KIF16B MISSION shRNA shRNA Plasmid DNA
kinesin family member 16B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024704.3-878s21c1
Sequence:CCGGGCCATGTGAAACCGTCAGTAACTCGAGTTACTGACGGTTTCACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024704.3-700s21c1
Sequence:CCGGGCCCTTATGTTGAGGATTTATCTCGAGATAAATCCTCAACATAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024704.3-4623s21c1
Sequence:CCGGCCTCATTTGAATCAGAACTTTCTCGAGAAAGTTCTGATTCAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024704.3-3628s21c1
Sequence:CCGGGCACCATTCAACGTAAACTAACTCGAGTTAGTTTACGTTGAATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-4623s1c1
Sequence:CCGGCCTCATTTGAATCAGAACTTTCTCGAGAAAGTTCTGATTCAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-700s1c1
Sequence:CCGGGCCCTTATGTTGAGGATTTATCTCGAGATAAATCCTCAACATAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-3628s1c1
Sequence:CCGGGCACCATTCAACGTAAACTAACTCGAGTTAGTTTACGTTGAATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-878s1c1
Sequence:CCGGGCCATGTGAAACCGTCAGTAACTCGAGTTACTGACGGTTTCACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024704.3-1206s1c1
Sequence:CCGGCGCTATGCAAATAGAGCCAAACTCGAGTTTGGCTCTATTTGCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024704
VALIDATED
KIF16B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 16B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024704.3-878s21c1
Sequence:CCGGGCCATGTGAAACCGTCAGTAACTCGAGTTACTGACGGTTTCACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024704.3-700s21c1
Sequence:CCGGGCCCTTATGTTGAGGATTTATCTCGAGATAAATCCTCAACATAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024704.3-4623s21c1
Sequence:CCGGCCTCATTTGAATCAGAACTTTCTCGAGAAAGTTCTGATTCAAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024704.3-3628s21c1
Sequence:CCGGGCACCATTCAACGTAAACTAACTCGAGTTAGTTTACGTTGAATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-4623s1c1
Sequence:CCGGCCTCATTTGAATCAGAACTTTCTCGAGAAAGTTCTGATTCAAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-700s1c1
Sequence:CCGGGCCCTTATGTTGAGGATTTATCTCGAGATAAATCCTCAACATAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-3628s1c1
Sequence:CCGGGCACCATTCAACGTAAACTAACTCGAGTTAGTTTACGTTGAATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024704.3-878s1c1
Sequence:CCGGGCCATGTGAAACCGTCAGTAACTCGAGTTACTGACGGTTTCACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024704.3-1206s1c1
Sequence:CCGGCGCTATGCAAATAGAGCCAAACTCGAGTTTGGCTCTATTTGCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081133
VALIDATED
KIF16B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 16B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-1729s21c1
Sequence:CCGGACCAACATGTTCCGCTTTAACCTCGAGGTTAAAGCGGAACATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-4805s21c1
Sequence:CCGGCAGAACCTTCAAGATCATTAACTCGAGTTAATGATCTTGAAGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-1168s21c1
Sequence:CCGGATCAACAAGCCTACCATTAATCTCGAGATTAATGGTAGGCTTGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-1681s21c1
Sequence:CCGGGTGGATGCCACGCAGCTAAATCTCGAGATTTAGCTGCGTGGCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-635s21c1
Sequence:CCGGGACCGTACGTTGAGGATTTATCTCGAGATAAATCCTCAACGTACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081133
VALIDATED
KIF16B MISSION shRNA shRNA Plasmid DNA
kinesin family member 16B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-1729s21c1
Sequence:CCGGACCAACATGTTCCGCTTTAACCTCGAGGTTAAAGCGGAACATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-4805s21c1
Sequence:CCGGCAGAACCTTCAAGATCATTAACTCGAGTTAATGATCTTGAAGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-1168s21c1
Sequence:CCGGATCAACAAGCCTACCATTAATCTCGAGATTAATGGTAGGCTTGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-1681s21c1
Sequence:CCGGGTGGATGCCACGCAGCTAAATCTCGAGATTTAGCTGCGTGGCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-635s21c1
Sequence:CCGGGACCGTACGTTGAGGATTTATCTCGAGATAAATCCTCAACGTACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081133
VALIDATED
KIF16B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 16B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-1729s21c1
Sequence:CCGGACCAACATGTTCCGCTTTAACCTCGAGGTTAAAGCGGAACATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-4805s21c1
Sequence:CCGGCAGAACCTTCAAGATCATTAACTCGAGTTAATGATCTTGAAGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-1168s21c1
Sequence:CCGGATCAACAAGCCTACCATTAATCTCGAGATTAATGGTAGGCTTGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-1681s21c1
Sequence:CCGGGTGGATGCCACGCAGCTAAATCTCGAGATTTAGCTGCGTGGCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081133.2-635s21c1
Sequence:CCGGGACCGTACGTTGAGGATTTATCTCGAGATAAATCCTCAACGTACGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)