EMAIL THIS PAGE TO A FRIEND

KIF18B

kinesin family member 18B

75 Gene Product Result for
UniProtKB ID: Q86Y91, A6NJI2, B7ZM49, B9EGM8, D5L6I1
Gene ID:
Mouse(70218) kinesin family member 18B
Rat(303575) kinesin family member 18B
chicken(419968) kinesin family member 18B
cow(511170) kinesin family member 18B
Horse(100050343) kinesin family member 18B
domestic cat(101082195) kinesin family member 18B
dog(490932) kinesin family member 18B
domestic guinea pig(100725454) kinesin family member 18B
naked mole-rat(101707524) kinesin family member 18B
sheep(101118461) kinesin family member 18B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080443 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080443 Rosetta Predictions human pricing
XM_085634 Rosetta Predictions human pricing
XM_929923 Rosetta Predictions human pricing
XM_934078 Rosetta Predictions human pricing
NM_001039019 Rosetta Predictions rat pricing
NM_197959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314896 predicted 1605
2 SASI_Hs02_00314897 predicted 1044
3 SASI_Hs02_00314898 predicted 559
4 SASI_Hs02_00314899 predicted 1714
5 SASI_Hs02_00314900 predicted 2038
6 SASI_Hs02_00314901 predicted 390
7 SASI_Hs02_00314902 predicted 1654
8 SASI_Hs02_00314903 predicted 291
9 SASI_Hs02_00314904 predicted 838
10 SASI_Hs02_00314905 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_085634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259180 predicted 1140
2 SASI_Hs01_00259181 predicted 1247
3 SASI_Hs01_00259182 predicted 399
4 SASI_Hs01_00259183 predicted 1655
5 SASI_Hs01_00259184 predicted 293
6 SASI_Hs01_00259185 predicted 1843
7 SASI_Hs01_00259186 predicted 840
8 SASI_Hs01_00259187 predicted 2314
9 SASI_Hs01_00259188 predicted 1641
10 SASI_Hs01_00259189 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297232 predicted 1145
2 SASI_Hs01_00297233 predicted 1244
3 SASI_Hs01_00297234 predicted 2643
4 SASI_Hs01_00297235 predicted 389
5 SASI_Hs01_00297236 predicted 1658
6 SASI_Hs01_00297237 predicted 286
7 SASI_Hs01_00297238 predicted 839
8 SASI_Hs01_00297239 predicted 1635
9 SASI_Hs01_00297240 predicted 1456
10 SASI_Hs01_00297241 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279270 predicted 1053
2 SASI_Hs01_00279271 predicted 562
3 SASI_Hs01_00279272 predicted 1433
4 SASI_Hs01_00279273 predicted 983
5 SASI_Hs01_00279274 predicted 1426
6 SASI_Hs01_00279275 predicted 398
7 SASI_Hs01_00279276 predicted 288
8 SASI_Hs01_00279277 predicted 764
9 SASI_Hs01_00279278 predicted 835
10 SASI_Hs01_00279279 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053809 predicted 940
2 SASI_Rn01_00053810 predicted 429
3 SASI_Rn01_00053811 predicted 1202
4 SASI_Rn01_00053812 predicted 355
5 SASI_Rn01_00053813 predicted 454
6 SASI_Rn01_00053814 predicted 1877
7 SASI_Rn01_00053815 predicted 242
8 SASI_Rn01_00053816 predicted 1172
9 SASI_Rn01_00053817 predicted 998
10 SASI_Rn01_00053818 predicted 1440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121771 predicted 309
2 SASI_Mm01_00121772 predicted 665
3 SASI_Mm02_00350659 predicted 1727
4 SASI_Mm01_00121773 predicted 2479
5 SASI_Mm01_00121774 predicted 1846
6 SASI_Mm01_00121775 predicted 1357
7 SASI_Mm02_00350660 predicted 387
8 SASI_Mm01_00121776 predicted 959
9 SASI_Mm01_00121778 predicted 198
10 SASI_Mm01_00121779 predicted 859
11 SASI_Mm01_00121777 predicted 1949
12 SASI_Mm01_00121780 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197959
VALIDATED
KIF18B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 18B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197959.1-2803s1c1
Sequence:CCGGGCCTTCTTTATTAGTCTCTTTCTCGAGAAAGAGACTAATAAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197959.1-960s1c1
Sequence:CCGGGCTCTCTGTTAGCACTCATTACTCGAGTAATGAGTGCTAACAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197959.1-961s1c1
Sequence:CCGGCTCTCTGTTAGCACTCATTAACTCGAGTTAATGAGTGCTAACAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197959.1-730s1c1
Sequence:CCGGGCTGACAAGAGGCAACTGTATCTCGAGATACAGTTGCCTCTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197959.1-1718s1c1
Sequence:CCGGCCTGACATGATCTCAGAGTTTCTCGAGAAACTCTGAGATCATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197959
VALIDATED
KIF18B MISSION shRNA shRNA Plasmid DNA
kinesin family member 18B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197959.1-2803s1c1
Sequence:CCGGGCCTTCTTTATTAGTCTCTTTCTCGAGAAAGAGACTAATAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197959.1-960s1c1
Sequence:CCGGGCTCTCTGTTAGCACTCATTACTCGAGTAATGAGTGCTAACAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197959.1-961s1c1
Sequence:CCGGCTCTCTGTTAGCACTCATTAACTCGAGTTAATGAGTGCTAACAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197959.1-730s1c1
Sequence:CCGGGCTGACAAGAGGCAACTGTATCTCGAGATACAGTTGCCTCTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197959.1-1718s1c1
Sequence:CCGGCCTGACATGATCTCAGAGTTTCTCGAGAAACTCTGAGATCATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197959
VALIDATED
KIF18B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 18B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197959.1-2803s1c1
Sequence:CCGGGCCTTCTTTATTAGTCTCTTTCTCGAGAAAGAGACTAATAAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197959.1-960s1c1
Sequence:CCGGGCTCTCTGTTAGCACTCATTACTCGAGTAATGAGTGCTAACAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197959.1-961s1c1
Sequence:CCGGCTCTCTGTTAGCACTCATTAACTCGAGTTAATGAGTGCTAACAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197959.1-730s1c1
Sequence:CCGGGCTGACAAGAGGCAACTGTATCTCGAGATACAGTTGCCTCTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197959.1-1718s1c1
Sequence:CCGGCCTGACATGATCTCAGAGTTTCTCGAGAAACTCTGAGATCATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080443
VALIDATED
KIF18B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 18B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-775s21c1
Sequence:CCGGATGCCATCTTCCAGATCTTTGCTCGAGCAAAGATCTGGAAGATGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080443.1-310s21c1
Sequence:CCGGTTGTCTTTGACCGGGTCTTTGCTCGAGCAAAGACCCGGTCAAAGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-1113s21c1
Sequence:CCGGACGTACAACACCCTCAAATATCTCGAGATATTTGAGGGTGTTGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-560s21c1
Sequence:CCGGCAGCTACCAGGAGGTGTATAACTCGAGTTATACACCTCCTGGTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-1647s21c1
Sequence:CCGGTCTAAGCAGTTGGCCCTAAAGCTCGAGCTTTAGGGCCAACTGCTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080443
VALIDATED
KIF18B MISSION shRNA shRNA Plasmid DNA
kinesin family member 18B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-775s21c1
Sequence:CCGGATGCCATCTTCCAGATCTTTGCTCGAGCAAAGATCTGGAAGATGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080443.1-310s21c1
Sequence:CCGGTTGTCTTTGACCGGGTCTTTGCTCGAGCAAAGACCCGGTCAAAGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-1113s21c1
Sequence:CCGGACGTACAACACCCTCAAATATCTCGAGATATTTGAGGGTGTTGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-560s21c1
Sequence:CCGGCAGCTACCAGGAGGTGTATAACTCGAGTTATACACCTCCTGGTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-1647s21c1
Sequence:CCGGTCTAAGCAGTTGGCCCTAAAGCTCGAGCTTTAGGGCCAACTGCTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080443
VALIDATED
KIF18B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 18B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-775s21c1
Sequence:CCGGATGCCATCTTCCAGATCTTTGCTCGAGCAAAGATCTGGAAGATGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080443.1-310s21c1
Sequence:CCGGTTGTCTTTGACCGGGTCTTTGCTCGAGCAAAGACCCGGTCAAAGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-1113s21c1
Sequence:CCGGACGTACAACACCCTCAAATATCTCGAGATATTTGAGGGTGTTGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-560s21c1
Sequence:CCGGCAGCTACCAGGAGGTGTATAACTCGAGTTATACACCTCCTGGTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080443.1-1647s21c1
Sequence:CCGGTCTAAGCAGTTGGCCCTAAAGCTCGAGCTTTAGGGCCAACTGCTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)