EMAIL THIS PAGE TO A FRIEND

KIF19

kinesin family member 19

49 Gene Product Result for
Synonyms: KIF19A
UniProtKB ID: Q2TAC6, A6NLG2, B7ZKR1, Q52M87, Q8N1X8, Q8TAB6
Gene ID:
Rat(303659) kinesin family member 19
sheep(101106188) kinesin family member 19
domestic guinea pig(100725282) kinesin family member 19
naked mole-rat(101721777) kinesin family member 19
Zebrafish(565913) kinesin family member 19
chicken(771601) kinesin family member 19
cow(538109) kinesin family member 19
Horse(100060836) kinesin family member 19
domestic cat(101087950) kinesin family member 19
dog(483285) kinesin family member 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153209 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074791 MISSION® esiRNA esiRNA human KIF19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153209 Rosetta Predictions human pricing
XM_221082 Rosetta Predictions rat pricing
XR_009479 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240416 predicted 1471
2 SASI_Hs02_00367055 predicted 2956
3 SASI_Hs01_00240420 predicted 918
4 SASI_Hs02_00367056 predicted 229
5 SASI_Hs02_00367057 predicted 3085
6 SASI_Hs01_00240421 predicted 835
7 SASI_Hs01_00240422 predicted 493
8 SASI_Hs02_00367058 predicted 1574
9 SASI_Hs02_00367059 predicted 2248
10 SASI_Hs02_00367060 predicted 2462
11 SASI_Hs01_00240417 predicted 1154
12 SASI_Hs01_00240418 predicted 938
13 SASI_Hs01_00240419 predicted 1039
14 SASI_Hs01_00240423 predicted 967
15 SASI_Hs01_00240424 predicted 636
16 SASI_Hs01_00240425 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379814 predicted 966
2 SASI_Rn02_00379815 predicted 1963
3 SASI_Rn02_00379816 predicted 405
4 SASI_Rn02_00379817 predicted 485
5 SASI_Rn02_00379818 predicted 1244
6 SASI_Rn02_00379819 predicted 355
7 SASI_Rn02_00379820 predicted 979
8 SASI_Rn02_00379821 predicted 1054
9 SASI_Rn02_00379822 predicted 1599
10 SASI_Rn02_00379823 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179987 predicted 2659
2 SASI_Rn01_00179988 predicted 2657
3 SASI_Rn01_00179989 predicted 2598
4 SASI_Rn01_00179990 predicted 2630
5 SASI_Rn01_00179991 predicted 2661
6 SASI_Rn01_00179992 predicted 2556
7 SASI_Rn01_00179993 predicted 2575
8 SASI_Rn01_00179994 predicted 2596
9 SASI_Rn01_00179995 predicted 2563
10 SASI_Rn01_00179996 predicted 2581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153209
KIF19 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 19
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-1795s1c1
Sequence:CCGGCCACAAATCCTGTGTGACTTTCTCGAGAAAGTCACACAGGATTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-459s1c1
Sequence:CCGGCATCTATGTTCAGACCCTCAACTCGAGTTGAGGGTCTGAACATAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153209.1-1794s1c1
Sequence:CCGGGCCACAAATCCTGTGTGACTTCTCGAGAAGTCACACAGGATTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-657s1c1
Sequence:CCGGCACCATCAATGCCAAGGAGATCTCGAGATCTCCTTGGCATTGATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-189s1c1
Sequence:CCGGCATCGCCCATAAAGTGGATGACTCGAGTCATCCACTTTATGGGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-516s1c1
Sequence:CCGGCATGGAGTATGAGGTCTCCATCTCGAGATGGAGACCTCATACTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-1222s1c1
Sequence:CCGGCGACTCAAGCGCAAGATTGATCTCGAGATCAATCTTGCGCTTGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-381s1c1
Sequence:CCGGCAATGCCACTGTCTTTGCCTACTCGAGTAGGCAAAGACAGTGGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-1125s1c1
Sequence:CCGGGAACATTAAGACTAGGGTGAACTCGAGTTCACCCTAGTCTTAATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153209
KIF19 MISSION shRNA shRNA Plasmid DNA
kinesin family member 19
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-1795s1c1
Sequence:CCGGCCACAAATCCTGTGTGACTTTCTCGAGAAAGTCACACAGGATTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-459s1c1
Sequence:CCGGCATCTATGTTCAGACCCTCAACTCGAGTTGAGGGTCTGAACATAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153209.1-1794s1c1
Sequence:CCGGGCCACAAATCCTGTGTGACTTCTCGAGAAGTCACACAGGATTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-657s1c1
Sequence:CCGGCACCATCAATGCCAAGGAGATCTCGAGATCTCCTTGGCATTGATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-189s1c1
Sequence:CCGGCATCGCCCATAAAGTGGATGACTCGAGTCATCCACTTTATGGGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-516s1c1
Sequence:CCGGCATGGAGTATGAGGTCTCCATCTCGAGATGGAGACCTCATACTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-1222s1c1
Sequence:CCGGCGACTCAAGCGCAAGATTGATCTCGAGATCAATCTTGCGCTTGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-381s1c1
Sequence:CCGGCAATGCCACTGTCTTTGCCTACTCGAGTAGGCAAAGACAGTGGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-1125s1c1
Sequence:CCGGGAACATTAAGACTAGGGTGAACTCGAGTTCACCCTAGTCTTAATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153209
KIF19 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 19
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-1795s1c1
Sequence:CCGGCCACAAATCCTGTGTGACTTTCTCGAGAAAGTCACACAGGATTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-459s1c1
Sequence:CCGGCATCTATGTTCAGACCCTCAACTCGAGTTGAGGGTCTGAACATAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153209.1-1794s1c1
Sequence:CCGGGCCACAAATCCTGTGTGACTTCTCGAGAAGTCACACAGGATTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-657s1c1
Sequence:CCGGCACCATCAATGCCAAGGAGATCTCGAGATCTCCTTGGCATTGATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-189s1c1
Sequence:CCGGCATCGCCCATAAAGTGGATGACTCGAGTCATCCACTTTATGGGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-516s1c1
Sequence:CCGGCATGGAGTATGAGGTCTCCATCTCGAGATGGAGACCTCATACTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-1222s1c1
Sequence:CCGGCGACTCAAGCGCAAGATTGATCTCGAGATCAATCTTGCGCTTGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153209.1-381s1c1
Sequence:CCGGCAATGCCACTGTCTTTGCCTACTCGAGTAGGCAAAGACAGTGGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153209.1-1125s1c1
Sequence:CCGGGAACATTAAGACTAGGGTGAACTCGAGTTCACCCTAGTCTTAATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)