EMAIL THIS PAGE TO A FRIEND

Kif19a

31 Gene Product Result for
Species: Mouse Kif19a(286942), fruit fly Kif19A(41717)
Gene ID:
fruit fly(41717) CG9913 gene product from transcript CG9913-RB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001102615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001102615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU169561 MISSION® esiRNA targeting mouse Kif19a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102615 Rosetta Predictions mouse pricing
XM_980203 Rosetta Predictions mouse pricing
XM_988580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303029 predicted 1006
2 SASI_Mm02_00303030 predicted 2801
3 SASI_Mm02_00303031 predicted 2646
4 SASI_Mm02_00303032 predicted 416
5 SASI_Mm02_00303033 predicted 220
6 SASI_Mm02_00303034 predicted 534
7 SASI_Mm02_00303035 predicted 481
8 SASI_Mm02_00303036 predicted 1067
9 SASI_Mm02_00303037 predicted 2796
10 SASI_Mm02_00303038 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447198 predicted 1008
2 SASI_Mm02_00447199 predicted 2801
3 SASI_Mm02_00447200 predicted 2642
4 SASI_Mm02_00447201 predicted 413
5 SASI_Mm02_00447202 predicted 222
6 SASI_Mm02_00447203 predicted 535
7 SASI_Mm02_00447204 predicted 487
8 SASI_Mm02_00447205 predicted 1072
9 SASI_Mm02_00447206 predicted 2800
10 SASI_Mm02_00447207 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248136 predicted 1018
2 SASI_Mm01_00248137 predicted 2803
3 SASI_Mm01_00248138 predicted 2647
4 SASI_Mm01_00248139 predicted 427
5 SASI_Mm01_00248140 predicted 230
6 SASI_Mm01_00248141 predicted 537
7 SASI_Mm01_00248142 predicted 488
8 SASI_Mm01_00248143 predicted 2810
9 SASI_Mm01_00248144 predicted 993
10 SASI_Mm01_00248145 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102615
Kif19a MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-348s21c1
Sequence:CCGGGCCACCCAGGAGATGGTATATCTCGAGATATACCATCTCCTGGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-3119s21c1
Sequence:CCGGAGGGACCCAGGCACCTATTATCTCGAGATAATAGGTGCCTGGGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102615.1-3242s21c1
Sequence:CCGGACCCGGAAACGGTAGAGTTATCTCGAGATAACTCTACCGTTTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-397s21c1
Sequence:CCGGGCGTCATCTCAGGGTACAATGCTCGAGCATTGTACCCTGAGATGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-2410s21c1
Sequence:CCGGAGATCCTTCTGTCCCATAAAGCTCGAGCTTTATGGGACAGAAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102615
Kif19a MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-348s21c1
Sequence:CCGGGCCACCCAGGAGATGGTATATCTCGAGATATACCATCTCCTGGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-3119s21c1
Sequence:CCGGAGGGACCCAGGCACCTATTATCTCGAGATAATAGGTGCCTGGGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102615.1-3242s21c1
Sequence:CCGGACCCGGAAACGGTAGAGTTATCTCGAGATAACTCTACCGTTTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-397s21c1
Sequence:CCGGGCGTCATCTCAGGGTACAATGCTCGAGCATTGTACCCTGAGATGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-2410s21c1
Sequence:CCGGAGATCCTTCTGTCCCATAAAGCTCGAGCTTTATGGGACAGAAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102615
Kif19a MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-348s21c1
Sequence:CCGGGCCACCCAGGAGATGGTATATCTCGAGATATACCATCTCCTGGGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000282414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-3119s21c1
Sequence:CCGGAGGGACCCAGGCACCTATTATCTCGAGATAATAGGTGCCTGGGTCCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000262736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102615.1-3242s21c1
Sequence:CCGGACCCGGAAACGGTAGAGTTATCTCGAGATAACTCTACCGTTTCCGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000262738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-397s21c1
Sequence:CCGGGCGTCATCTCAGGGTACAATGCTCGAGCATTGTACCCTGAGATGACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000262737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102615.1-2410s21c1
Sequence:CCGGAGATCCTTCTGTCCCATAAAGCTCGAGCTTTATGGGACAGAAGGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???