EMAIL THIS PAGE TO A FRIEND

KIF1A

kinesin family member 1A

116 Gene Product Result for
Synonyms: ATSV C2orf20 HSN2C MRD9 SPG30 UNC104
Gene ID:
Human(547) Summary: The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
Mouse(16560) kinesin family member 1A
Rat(363288) kinesin family member 1A
sheep(101103691) kinesin family member 1A
domestic guinea pig(100725318) kinesin family member 1A
naked mole-rat(101705900) kinesin family member 1A
Zebrafish(100330443) kinesin family member 1A
chicken(424849) kinesin family member 1A
domestic cat(101095360) kinesin family member 1A
cow(527883) kinesin family member 1A
Horse(100057836) kinesin family member 1A
dog(486202) kinesin family member 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004321 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004321 Rosetta Predictions human pricing
XM_001070053 Rosetta Predictions rat pricing
XM_001070204 Rosetta Predictions rat pricing
XM_343630 Rosetta Predictions rat pricing
NM_001110315 Rosetta Predictions mouse pricing
NM_008440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135293 predicted 3282
2 SASI_Hs01_00135294 predicted 4246
3 SASI_Hs01_00135295 predicted 3706
4 SASI_Hs02_00337359 predicted 2220
5 SASI_Hs01_00135296 predicted 3671
6 SASI_Hs01_00135297 predicted 2185
7 SASI_Hs01_00135298 predicted 3179
8 SASI_Hs01_00135299 predicted 200
9 SASI_Hs01_00135301 predicted 3838
10 SASI_Hs02_00337360 predicted 3704
11 SASI_Hs01_00135300 predicted 1118
12 SASI_Hs01_00135302 predicted 2841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330254 predicted 4296
2 SASI_Rn02_00330255 predicted 3192
3 SASI_Rn02_00330256 predicted 2887
4 SASI_Rn02_00330257 predicted 5267
5 SASI_Rn02_00330258 predicted 952
6 SASI_Rn02_00330259 predicted 223
7 SASI_Rn02_00330260 predicted 3578
8 SASI_Rn02_00330261 predicted 3285
9 SASI_Rn02_00330262 predicted 3176
10 SASI_Rn02_00330263 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330777 predicted 4337
2 SASI_Rn02_00330778 predicted 3209
3 SASI_Rn02_00330779 predicted 2896
4 SASI_Rn02_00330780 predicted 5308
5 SASI_Rn02_00330781 predicted 953
6 SASI_Rn02_00330782 predicted 224
7 SASI_Rn02_00330783 predicted 3607
8 SASI_Rn02_00330784 predicted 3309
9 SASI_Rn02_00330785 predicted 3199
10 SASI_Rn02_00330786 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396128 predicted 2555
2 SASI_Rn02_00396129 predicted 487
3 SASI_Rn02_00396130 predicted 2359
4 SASI_Rn02_00396131 predicted 559
5 SASI_Rn02_00396132 predicted 2042
6 SASI_Rn02_00396133 predicted 896
7 SASI_Rn02_00396134 predicted 471
8 SASI_Rn02_00396135 predicted 2811
9 SASI_Rn02_00396136 predicted 2452
10 SASI_Rn02_00396137 predicted 2350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305366 predicted 5273
2 SASI_Mm02_00305367 predicted 2051
3 SASI_Mm02_00305368 predicted 1482
4 SASI_Mm02_00305369 predicted 208
5 SASI_Mm02_00305370 predicted 4960
6 SASI_Mm02_00305371 predicted 2262
7 SASI_Mm02_00305372 predicted 2272
8 SASI_Mm02_00305373 predicted 3597
9 SASI_Mm02_00305374 predicted 400
10 SASI_Mm02_00305375 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313924 predicted 5302
2 SASI_Mm01_00060300 predicted 2044
3 SASI_Mm01_00060302 predicted 1481
4 SASI_Mm02_00313925 predicted 208
5 SASI_Mm01_00060303 predicted 4988
6 SASI_Mm01_00060304 predicted 2263
7 SASI_Mm01_00060305 predicted 2276
8 SASI_Mm01_00060306 predicted 3592
9 SASI_Mm01_00060307 predicted 393
10 SASI_Mm01_00060308 predicted 998
11 SASI_Mm01_00060301 predicted 4248
12 SASI_Mm01_00060309 predicted 2796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004321
VALIDATED
KIF1A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 1A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004321.4-5489s21c1
Sequence:CCGGGGTTCTTGCTGCCGTTCTAATCTCGAGATTAGAACGGCAGCAAGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004321.4-186s21c1
Sequence:CCGGCCCTTCAATTCCCGGGAAATGCTCGAGCATTTCCCGGGAATTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004321.4-211s21c1
Sequence:CCGGGTGACTCCAAGTGCATCATTCCTCGAGGAATGATGCACTTGGAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004321.4-3174s21c1
Sequence:CCGGTCCAGCATCTCTGCCGAATATCTCGAGATATTCGGCAGAGATGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004321.4-834s21c1
Sequence:CCGGCATGACGCAGAGACCAATATCCTCGAGGATATTGGTCTCTGCGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-8290s1c1
Sequence:CCGGGCTGAGAAGATGCCAATGTTTCTCGAGAAACATTGGCATCTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-1106s1c1
Sequence:CCGGCGGTAACTCAAGGACAGCTATCTCGAGATAGCTGTCCTTGAGTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-3953s1c1
Sequence:CCGGCGCTTATATCGAGATGGAGAACTCGAGTTCTCCATCTCGATATAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-1016s1c1
Sequence:CCGGCGGACCCAACAAGAACAAGAACTCGAGTTCTTGTTCTTGTTGGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-3952s1c1
Sequence:CCGGCCGCTTATATCGAGATGGAGACTCGAGTCTCCATCTCGATATAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004321
VALIDATED
KIF1A MISSION shRNA shRNA Plasmid DNA
kinesin family member 1A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004321.4-5489s21c1
Sequence:CCGGGGTTCTTGCTGCCGTTCTAATCTCGAGATTAGAACGGCAGCAAGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004321.4-186s21c1
Sequence:CCGGCCCTTCAATTCCCGGGAAATGCTCGAGCATTTCCCGGGAATTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004321.4-211s21c1
Sequence:CCGGGTGACTCCAAGTGCATCATTCCTCGAGGAATGATGCACTTGGAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004321.4-3174s21c1
Sequence:CCGGTCCAGCATCTCTGCCGAATATCTCGAGATATTCGGCAGAGATGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004321.4-834s21c1
Sequence:CCGGCATGACGCAGAGACCAATATCCTCGAGGATATTGGTCTCTGCGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-8290s1c1
Sequence:CCGGGCTGAGAAGATGCCAATGTTTCTCGAGAAACATTGGCATCTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-1106s1c1
Sequence:CCGGCGGTAACTCAAGGACAGCTATCTCGAGATAGCTGTCCTTGAGTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-3953s1c1
Sequence:CCGGCGCTTATATCGAGATGGAGAACTCGAGTTCTCCATCTCGATATAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-1016s1c1
Sequence:CCGGCGGACCCAACAAGAACAAGAACTCGAGTTCTTGTTCTTGTTGGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-3952s1c1
Sequence:CCGGCCGCTTATATCGAGATGGAGACTCGAGTCTCCATCTCGATATAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004321
VALIDATED
KIF1A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 1A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004321.4-5489s21c1
Sequence:CCGGGGTTCTTGCTGCCGTTCTAATCTCGAGATTAGAACGGCAGCAAGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004321.4-186s21c1
Sequence:CCGGCCCTTCAATTCCCGGGAAATGCTCGAGCATTTCCCGGGAATTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004321.4-211s21c1
Sequence:CCGGGTGACTCCAAGTGCATCATTCCTCGAGGAATGATGCACTTGGAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004321.4-3174s21c1
Sequence:CCGGTCCAGCATCTCTGCCGAATATCTCGAGATATTCGGCAGAGATGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004321.4-834s21c1
Sequence:CCGGCATGACGCAGAGACCAATATCCTCGAGGATATTGGTCTCTGCGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-8290s1c1
Sequence:CCGGGCTGAGAAGATGCCAATGTTTCTCGAGAAACATTGGCATCTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-1106s1c1
Sequence:CCGGCGGTAACTCAAGGACAGCTATCTCGAGATAGCTGTCCTTGAGTTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-3953s1c1
Sequence:CCGGCGCTTATATCGAGATGGAGAACTCGAGTTCTCCATCTCGATATAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-1016s1c1
Sequence:CCGGCGGACCCAACAAGAACAAGAACTCGAGTTCTTGTTCTTGTTGGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004321.4-3952s1c1
Sequence:CCGGCCGCTTATATCGAGATGGAGACTCGAGTCTCCATCTCGATATAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008440
KIF1A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008440.1-5254s1c1
Sequence:CCGGCCTTACCATCTGTTCTGTCATCTCGAGATGACAGAACAGATGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-1171s1c1
Sequence:CCGGGCCAAACAAATCCGCTGCAATCTCGAGATTGCAGCGGATTTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-775s1c1
Sequence:CCGGGCAGTCTTCAACATCATCTTTCTCGAGAAAGATGATGTTGAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-4746s1c1
Sequence:CCGGCCTGCCAGAACTTGACTCTAACTCGAGTTAGAGTCAAGTTCTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-3143s1c1
Sequence:CCGGCGTCCAGTATCTCTGCTGAATCTCGAGATTCAGCAGAGATACTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008440
KIF1A MISSION shRNA shRNA Plasmid DNA
kinesin family member 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008440.1-5254s1c1
Sequence:CCGGCCTTACCATCTGTTCTGTCATCTCGAGATGACAGAACAGATGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-1171s1c1
Sequence:CCGGGCCAAACAAATCCGCTGCAATCTCGAGATTGCAGCGGATTTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-775s1c1
Sequence:CCGGGCAGTCTTCAACATCATCTTTCTCGAGAAAGATGATGTTGAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-4746s1c1
Sequence:CCGGCCTGCCAGAACTTGACTCTAACTCGAGTTAGAGTCAAGTTCTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-3143s1c1
Sequence:CCGGCGTCCAGTATCTCTGCTGAATCTCGAGATTCAGCAGAGATACTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008440
KIF1A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008440.1-5254s1c1
Sequence:CCGGCCTTACCATCTGTTCTGTCATCTCGAGATGACAGAACAGATGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-1171s1c1
Sequence:CCGGGCCAAACAAATCCGCTGCAATCTCGAGATTGCAGCGGATTTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-775s1c1
Sequence:CCGGGCAGTCTTCAACATCATCTTTCTCGAGAAAGATGATGTTGAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-4746s1c1
Sequence:CCGGCCTGCCAGAACTTGACTCTAACTCGAGTTAGAGTCAAGTTCTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008440.1-3143s1c1
Sequence:CCGGCGTCCAGTATCTCTGCTGAATCTCGAGATTCAGCAGAGATACTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)