EMAIL THIS PAGE TO A FRIEND

KIF1B

kinesin family member 1B

150 Gene Product Result for
Synonyms: CMT2 CMT2A CMT2A1 HMSNII KLP NBLST1
Gene ID:
Human(23095) Summary: This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
Mouse(16561) kinesin family member 1B
Rat(117548) kinesin family member 1B
Zebrafish(369190) kinesin family member 1B
chicken(419449) kinesin family member 1B
cow(100337161) kinesin family member 1B
Horse(100057126) kinesin family member 1B
domestic cat(101095508) kinesin family member 1B
dog(479605) kinesin family member 1B
domestic guinea pig(100719514) kinesin family member 1B
naked mole-rat(101705122) kinesin family member 1B
sheep(101115220) kinesin family member 1B
Domestic Rabbit(100355710) kinesin family member 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015074 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015074 Rosetta Predictions human pricing
NM_183416 Rosetta Predictions human pricing
NM_057200 Rosetta Predictions rat pricing
NM_008441 Rosetta Predictions mouse pricing
NM_207682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013655 predicted 1163
2 SASI_Hs01_00013656 predicted 1195
3 SASI_Hs02_00346936 predicted 1763
4 SASI_Hs01_00013658 predicted 1465
5 SASI_Hs02_00346937 predicted 1124
6 SASI_Hs02_00346938 predicted 673
7 SASI_Hs01_00013659 predicted 1597
8 SASI_Hs01_00013660 predicted 1938
9 SASI_Hs01_00013661 predicted 422
10 SASI_Hs01_00013662 predicted 1490
11 SASI_Hs01_00013654 predicted 446
12 SASI_Hs01_00013657 predicted 1185
13 SASI_Hs01_00013663 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206645 predicted 1160
2 SASI_Hs01_00206646 predicted 1201
3 SASI_Hs02_00371317 predicted 1762
4 SASI_Hs01_00206648 predicted 1471
5 SASI_Hs02_00371318 predicted 1122
6 SASI_Hs02_00371319 predicted 670
7 SASI_Hs01_00206649 predicted 1588
8 SASI_Hs01_00206650 predicted 1944
9 SASI_Hs01_00206651 predicted 421
10 SASI_Hs01_00206652 predicted 1487
11 SASI_Hs01_00206644 predicted 452
12 SASI_Hs01_00206647 predicted 1190
13 SASI_Hs01_00206653 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067410 predicted 1142
2 SASI_Rn01_00067411 predicted 1381
3 SASI_Rn02_00267150 predicted 3419
4 SASI_Rn01_00067413 predicted 5534
5 SASI_Rn01_00067414 predicted 808
6 SASI_Rn02_00267151 predicted 3576
7 SASI_Rn01_00067416 predicted 1704
8 SASI_Rn01_00067417 predicted 2007
9 SASI_Rn01_00067418 predicted 5714
10 SASI_Rn01_00067419 predicted 608
11 SASI_Rn01_00067412 predicted 4509
12 SASI_Rn01_00067415 predicted 5101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091956 predicted 1817
2 SASI_Mm01_00091957 predicted 1152
3 SASI_Mm01_00091958 predicted 475
4 SASI_Mm01_00091959 predicted 1128
5 SASI_Mm01_00091960 predicted 1035
6 SASI_Mm01_00091961 predicted 824
7 SASI_Mm01_00091962 predicted 1802
8 SASI_Mm01_00091963 predicted 800
9 SASI_Mm01_00091964 predicted 1955
10 SASI_Mm01_00091965 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109043 predicted 1817
2 SASI_Mm01_00109044 predicted 1156
3 SASI_Mm01_00109045 predicted 470
4 SASI_Mm01_00109046 predicted 1122
5 SASI_Mm01_00109047 predicted 1035
6 SASI_Mm01_00109048 predicted 825
7 SASI_Mm01_00109049 predicted 1802
8 SASI_Mm01_00109050 predicted 798
9 SASI_Mm01_00109051 predicted 1962
10 SASI_Mm01_00109052 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207682
VALIDATED
KIF1B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 1B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-1180s1c1
Sequence:CCGGGCCGACATCAACTACGATGAACTCGAGTTCATCGTAGTTGATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-1900s1c1
Sequence:CCGGGCCCACATTAAAGAGGAGCATCTCGAGATGCTCCTCTTTAATGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-4950s1c1
Sequence:CCGGCCACACTTTCAACCGAGAATTCTCGAGAATTCTCGGTTGAAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-9267s1c1
Sequence:CCGGGCCGAGAGATTATTGCTGTTACTCGAGTAACAGCAATAATCTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207682.1-1901s1c1
Sequence:CCGGCCCACATTAAAGAGGAGCATTCTCGAGAATGCTCCTCTTTAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207682.2-9292s21c1
Sequence:CCGGGCCGAGAGATTATTGCTGTTACTCGAGTAACAGCAATAATCTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-1809s21c1
Sequence:CCGGCCTCAATGAAGACCCATTAATCTCGAGATTAATGGGTCTTCATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-588s21c1
Sequence:CCGGACATGCCTTTGAAGGTTATAACTCGAGTTATAACCTTCAAAGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-1321s21c1
Sequence:CCGGGCCGACATCAACTACGATGAACTCGAGTTCATCGTAGTTGATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-1831s21c1
Sequence:CCGGTCGGAGTGTTTGCTCTATTACCTCGAGGTAATAGAGCAAACACTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207682
VALIDATED
KIF1B MISSION shRNA shRNA Plasmid DNA
kinesin family member 1B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-1180s1c1
Sequence:CCGGGCCGACATCAACTACGATGAACTCGAGTTCATCGTAGTTGATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-1900s1c1
Sequence:CCGGGCCCACATTAAAGAGGAGCATCTCGAGATGCTCCTCTTTAATGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-4950s1c1
Sequence:CCGGCCACACTTTCAACCGAGAATTCTCGAGAATTCTCGGTTGAAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-9267s1c1
Sequence:CCGGGCCGAGAGATTATTGCTGTTACTCGAGTAACAGCAATAATCTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207682.1-1901s1c1
Sequence:CCGGCCCACATTAAAGAGGAGCATTCTCGAGAATGCTCCTCTTTAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207682.2-9292s21c1
Sequence:CCGGGCCGAGAGATTATTGCTGTTACTCGAGTAACAGCAATAATCTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-1809s21c1
Sequence:CCGGCCTCAATGAAGACCCATTAATCTCGAGATTAATGGGTCTTCATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-588s21c1
Sequence:CCGGACATGCCTTTGAAGGTTATAACTCGAGTTATAACCTTCAAAGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-1321s21c1
Sequence:CCGGGCCGACATCAACTACGATGAACTCGAGTTCATCGTAGTTGATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-1831s21c1
Sequence:CCGGTCGGAGTGTTTGCTCTATTACCTCGAGGTAATAGAGCAAACACTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207682
VALIDATED
KIF1B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 1B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-1180s1c1
Sequence:CCGGGCCGACATCAACTACGATGAACTCGAGTTCATCGTAGTTGATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-1900s1c1
Sequence:CCGGGCCCACATTAAAGAGGAGCATCTCGAGATGCTCCTCTTTAATGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-4950s1c1
Sequence:CCGGCCACACTTTCAACCGAGAATTCTCGAGAATTCTCGGTTGAAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207682.1-9267s1c1
Sequence:CCGGGCCGAGAGATTATTGCTGTTACTCGAGTAACAGCAATAATCTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207682.1-1901s1c1
Sequence:CCGGCCCACATTAAAGAGGAGCATTCTCGAGAATGCTCCTCTTTAATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207682.2-9292s21c1
Sequence:CCGGGCCGAGAGATTATTGCTGTTACTCGAGTAACAGCAATAATCTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-1809s21c1
Sequence:CCGGCCTCAATGAAGACCCATTAATCTCGAGATTAATGGGTCTTCATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-588s21c1
Sequence:CCGGACATGCCTTTGAAGGTTATAACTCGAGTTATAACCTTCAAAGGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-1321s21c1
Sequence:CCGGGCCGACATCAACTACGATGAACTCGAGTTCATCGTAGTTGATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207682.2-1831s21c1
Sequence:CCGGTCGGAGTGTTTGCTCTATTACCTCGAGGTAATAGAGCAAACACTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015074
VALIDATED
KIF1B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 1B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_015074.2-8472s1c1
Sequence:CCGGGCGGGAAAGTTAAGAAACATACTCGAGTATGTTTCTTAACTTTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015074.2-3608s1c1
Sequence:CCGGGCCTATTGTATTTGAAGTCTTCTCGAGAAGACTTCAAATACAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015074.2-1263s1c1
Sequence:CCGGGCCAAACTGGTTCGTGAATTACTCGAGTAATTCACGAACCAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015074.2-1767s1c1
Sequence:CCGGGCTCACATTAAAGAAGAGCATCTCGAGATGCTCTTCTTTAATGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_015074.2-2591s1c1
Sequence:CCGGGCTGGATTTGATGCGAGAGATCTCGAGATCTCTCGCATCAAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015074.3-8951s21c1
Sequence:CCGGCAACTAAGAAACCACTATTATCTCGAGATAATAGTGGTTTCTTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015074.3-4060s21c1
Sequence:CCGGGTAGGTCGTATTCGGAATAAGCTCGAGCTTATTCCGAATACGACCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015074.3-501s21c1
Sequence:CCGGACACGCCTTTGAGGGATATAACTCGAGTTATATCCCTCAAAGGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015074.3-1029s21c1
Sequence:CCGGTGCCAAAGGGACTCGATTAAACTCGAGTTTAATCGAGTCCCTTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015074
VALIDATED
KIF1B MISSION shRNA shRNA Plasmid DNA
kinesin family member 1B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_015074.2-8472s1c1
Sequence:CCGGGCGGGAAAGTTAAGAAACATACTCGAGTATGTTTCTTAACTTTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015074.2-3608s1c1
Sequence:CCGGGCCTATTGTATTTGAAGTCTTCTCGAGAAGACTTCAAATACAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015074.2-1263s1c1
Sequence:CCGGGCCAAACTGGTTCGTGAATTACTCGAGTAATTCACGAACCAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015074.2-1767s1c1
Sequence:CCGGGCTCACATTAAAGAAGAGCATCTCGAGATGCTCTTCTTTAATGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_015074.2-2591s1c1
Sequence:CCGGGCTGGATTTGATGCGAGAGATCTCGAGATCTCTCGCATCAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015074.3-8951s21c1
Sequence:CCGGCAACTAAGAAACCACTATTATCTCGAGATAATAGTGGTTTCTTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015074.3-4060s21c1
Sequence:CCGGGTAGGTCGTATTCGGAATAAGCTCGAGCTTATTCCGAATACGACCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015074.3-501s21c1
Sequence:CCGGACACGCCTTTGAGGGATATAACTCGAGTTATATCCCTCAAAGGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015074.3-1029s21c1
Sequence:CCGGTGCCAAAGGGACTCGATTAAACTCGAGTTTAATCGAGTCCCTTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015074
VALIDATED
KIF1B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 1B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_015074.2-8472s1c1
Sequence:CCGGGCGGGAAAGTTAAGAAACATACTCGAGTATGTTTCTTAACTTTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015074.2-3608s1c1
Sequence:CCGGGCCTATTGTATTTGAAGTCTTCTCGAGAAGACTTCAAATACAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015074.2-1263s1c1
Sequence:CCGGGCCAAACTGGTTCGTGAATTACTCGAGTAATTCACGAACCAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015074.2-1767s1c1
Sequence:CCGGGCTCACATTAAAGAAGAGCATCTCGAGATGCTCTTCTTTAATGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_015074.2-2591s1c1
Sequence:CCGGGCTGGATTTGATGCGAGAGATCTCGAGATCTCTCGCATCAAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015074.3-8951s21c1
Sequence:CCGGCAACTAAGAAACCACTATTATCTCGAGATAATAGTGGTTTCTTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015074.3-4060s21c1
Sequence:CCGGGTAGGTCGTATTCGGAATAAGCTCGAGCTTATTCCGAATACGACCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015074.3-501s21c1
Sequence:CCGGACACGCCTTTGAGGGATATAACTCGAGTTATATCCCTCAAAGGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015074.3-1029s21c1
Sequence:CCGGTGCCAAAGGGACTCGATTAAACTCGAGTTTAATCGAGTCCCTTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)