EMAIL THIS PAGE TO A FRIEND

KIF20A

kinesin family member 20A

57 Gene Product Result for
Synonyms: MKLP2 RAB6KIFL
UniProtKB ID: O95235, D3DQB6
Gene ID:
Mouse(19348) kinesin family member 20A
Rat(361308) kinesin family member 20A
chicken(416220) kinesin family member 20A
cow(527854) kinesin family member 20A
Horse(100062393) kinesin family member 20A
domestic cat(101086197) kinesin family member 20A
dog(474693) kinesin family member 20A
chicken(777490) kinesin family member 20A
domestic guinea pig(100735247) kinesin family member 20A
naked mole-rat(101712116) kinesin family member 20A
sheep(101109352) kinesin family member 20A
Domestic Rabbit(100345407) kinesin family member 20A
Gene Class: Cell_Division
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005733 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005733 Rosetta Predictions human pricing
NM_001108426 Rosetta Predictions rat pricing
NM_009004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034724 predicted 646
2 SASI_Hs01_00034725 predicted 1801
3 SASI_Hs02_00340167 predicted 1680
4 SASI_Hs01_00034726 predicted 1106
5 SASI_Hs01_00034727 predicted 2626
6 SASI_Hs01_00034728 predicted 477
7 SASI_Hs01_00034729 predicted 743
8 SASI_Hs01_00034732 predicted 2141
9 SASI_Hs01_00034733 predicted 2131
10 SASI_Hs02_00340168 predicted 536
11 SASI_Hs01_00034730 predicted 958
12 SASI_Hs01_00034731 predicted 2358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238519 predicted 696
2 SASI_Rn02_00238520 predicted 490
3 SASI_Rn02_00238521 predicted 1435
4 SASI_Rn02_00238522 predicted 1267
5 SASI_Rn02_00238523 predicted 990
6 SASI_Rn02_00238524 predicted 264
7 SASI_Rn02_00238525 predicted 1504
8 SASI_Rn02_00238526 predicted 1105
9 SASI_Rn02_00238527 predicted 1518
10 SASI_Rn02_00238528 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077305 predicted 1005
2 SASI_Mm01_00077306 predicted 2347
3 SASI_Mm01_00077307 predicted 907
4 SASI_Mm01_00077308 predicted 1450
5 SASI_Mm01_00077309 predicted 1508
6 SASI_Mm01_00077310 predicted 286
7 SASI_Mm01_00077311 predicted 1111
8 SASI_Mm01_00077312 predicted 697
9 SASI_Mm01_00077313 predicted 1544
10 SASI_Mm01_00077314 predicted 1527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009004
VALIDATED
KIF20A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 20A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009004.2-3115s1c1
Sequence:CCGGGCCAGGAAGTTGCTATGTCAACTCGAGTTGACATAGCAACTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009004.2-586s1c1
Sequence:CCGGCGTACACCATTCAAGGTACTACTCGAGTAGTACCTTGAATGGTGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009004.2-909s1c1
Sequence:CCGGCAGCTAGATGAAACAAGTCAACTCGAGTTGACTTGTTTCATCTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009004.2-435s1c1
Sequence:CCGGGCCACTCACAAATTTACCTTTCTCGAGAAAGGTAAATTTGTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009004.2-911s1c1
Sequence:CCGGGCTAGATGAAACAAGTCAATTCTCGAGAATTGACTTGTTTCATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-1853s21c1
Sequence:CCGGGAGGAAATTTGCAACGAAATGCTCGAGCATTTCGTTGCAAATTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-434s21c1
Sequence:CCGGGCCACTCACAAATTTACCTTTCTCGAGAAAGGTAAATTTGTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-910s21c1
Sequence:CCGGGCTAGATGAAACAAGTCAATTCTCGAGAATTGACTTGTTTCATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-585s21c1
Sequence:CCGGCGTACACCATTCAAGGTACTACTCGAGTAGTACCTTGAATGGTGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-141s21c1
Sequence:CCGGTTGTAGACTCTCCCATATTAGCTCGAGCTAATATGGGAGAGTCTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009004
VALIDATED
KIF20A MISSION shRNA shRNA Plasmid DNA
kinesin family member 20A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009004.2-3115s1c1
Sequence:CCGGGCCAGGAAGTTGCTATGTCAACTCGAGTTGACATAGCAACTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009004.2-586s1c1
Sequence:CCGGCGTACACCATTCAAGGTACTACTCGAGTAGTACCTTGAATGGTGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009004.2-909s1c1
Sequence:CCGGCAGCTAGATGAAACAAGTCAACTCGAGTTGACTTGTTTCATCTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009004.2-435s1c1
Sequence:CCGGGCCACTCACAAATTTACCTTTCTCGAGAAAGGTAAATTTGTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009004.2-911s1c1
Sequence:CCGGGCTAGATGAAACAAGTCAATTCTCGAGAATTGACTTGTTTCATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-1853s21c1
Sequence:CCGGGAGGAAATTTGCAACGAAATGCTCGAGCATTTCGTTGCAAATTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-434s21c1
Sequence:CCGGGCCACTCACAAATTTACCTTTCTCGAGAAAGGTAAATTTGTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-910s21c1
Sequence:CCGGGCTAGATGAAACAAGTCAATTCTCGAGAATTGACTTGTTTCATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-585s21c1
Sequence:CCGGCGTACACCATTCAAGGTACTACTCGAGTAGTACCTTGAATGGTGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-141s21c1
Sequence:CCGGTTGTAGACTCTCCCATATTAGCTCGAGCTAATATGGGAGAGTCTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009004
VALIDATED
KIF20A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 20A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009004.2-3115s1c1
Sequence:CCGGGCCAGGAAGTTGCTATGTCAACTCGAGTTGACATAGCAACTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009004.2-586s1c1
Sequence:CCGGCGTACACCATTCAAGGTACTACTCGAGTAGTACCTTGAATGGTGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009004.2-909s1c1
Sequence:CCGGCAGCTAGATGAAACAAGTCAACTCGAGTTGACTTGTTTCATCTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009004.2-435s1c1
Sequence:CCGGGCCACTCACAAATTTACCTTTCTCGAGAAAGGTAAATTTGTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009004.2-911s1c1
Sequence:CCGGGCTAGATGAAACAAGTCAATTCTCGAGAATTGACTTGTTTCATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-1853s21c1
Sequence:CCGGGAGGAAATTTGCAACGAAATGCTCGAGCATTTCGTTGCAAATTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-434s21c1
Sequence:CCGGGCCACTCACAAATTTACCTTTCTCGAGAAAGGTAAATTTGTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-910s21c1
Sequence:CCGGGCTAGATGAAACAAGTCAATTCTCGAGAATTGACTTGTTTCATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-585s21c1
Sequence:CCGGCGTACACCATTCAAGGTACTACTCGAGTAGTACCTTGAATGGTGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009004.3-141s21c1
Sequence:CCGGTTGTAGACTCTCCCATATTAGCTCGAGCTAATATGGGAGAGTCTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005733
VALIDATED
KIF20A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 20A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005733.1-2754s1c1
Sequence:CCGGCCTGAAGAAATAGGTCTCTTTCTCGAGAAAGAGACCTATTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-1455s1c1
Sequence:CCGGCCGTTCCTGCATGATTGTCAACTCGAGTTGACAATCATGCAGGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-2237s1c1
Sequence:CCGGGCCAGAAGAATATAAGGCTGTCTCGAGACAGCCTTATATTCTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-2118s1c1
Sequence:CCGGGCAGTGCAAAGCAGAGCTAAACTCGAGTTTAGCTCTGCTTTGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-68s1c1
Sequence:CCGGCCGATGACGATGTCGTAGTTTCTCGAGAAACTACGACATCGTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005733.2-3223s21c1
Sequence:CCGGCCTGAAGAAATAGGTCTCTTTCTCGAGAAAGAGACCTATTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005733.2-2587s21c1
Sequence:CCGGGCAGTGCAAAGCAGAGCTAAACTCGAGTTTAGCTCTGCTTTGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005733.2-1924s21c1
Sequence:CCGGCCGTTCCTGCATGATTGTCAACTCGAGTTGACAATCATGCAGGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005733.2-537s21c1
Sequence:CCGGCCGATGACGATGTCGTAGTTTCTCGAGAAACTACGACATCGTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005733
VALIDATED
KIF20A MISSION shRNA shRNA Plasmid DNA
kinesin family member 20A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005733.1-2754s1c1
Sequence:CCGGCCTGAAGAAATAGGTCTCTTTCTCGAGAAAGAGACCTATTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-1455s1c1
Sequence:CCGGCCGTTCCTGCATGATTGTCAACTCGAGTTGACAATCATGCAGGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-2237s1c1
Sequence:CCGGGCCAGAAGAATATAAGGCTGTCTCGAGACAGCCTTATATTCTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-2118s1c1
Sequence:CCGGGCAGTGCAAAGCAGAGCTAAACTCGAGTTTAGCTCTGCTTTGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-68s1c1
Sequence:CCGGCCGATGACGATGTCGTAGTTTCTCGAGAAACTACGACATCGTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005733.2-3223s21c1
Sequence:CCGGCCTGAAGAAATAGGTCTCTTTCTCGAGAAAGAGACCTATTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005733.2-2587s21c1
Sequence:CCGGGCAGTGCAAAGCAGAGCTAAACTCGAGTTTAGCTCTGCTTTGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005733.2-1924s21c1
Sequence:CCGGCCGTTCCTGCATGATTGTCAACTCGAGTTGACAATCATGCAGGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005733.2-537s21c1
Sequence:CCGGCCGATGACGATGTCGTAGTTTCTCGAGAAACTACGACATCGTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005733
VALIDATED
KIF20A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 20A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005733.1-2754s1c1
Sequence:CCGGCCTGAAGAAATAGGTCTCTTTCTCGAGAAAGAGACCTATTTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-1455s1c1
Sequence:CCGGCCGTTCCTGCATGATTGTCAACTCGAGTTGACAATCATGCAGGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-2237s1c1
Sequence:CCGGGCCAGAAGAATATAAGGCTGTCTCGAGACAGCCTTATATTCTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-2118s1c1
Sequence:CCGGGCAGTGCAAAGCAGAGCTAAACTCGAGTTTAGCTCTGCTTTGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005733.1-68s1c1
Sequence:CCGGCCGATGACGATGTCGTAGTTTCTCGAGAAACTACGACATCGTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005733.2-3223s21c1
Sequence:CCGGCCTGAAGAAATAGGTCTCTTTCTCGAGAAAGAGACCTATTTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005733.2-2587s21c1
Sequence:CCGGGCAGTGCAAAGCAGAGCTAAACTCGAGTTTAGCTCTGCTTTGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005733.2-1924s21c1
Sequence:CCGGCCGTTCCTGCATGATTGTCAACTCGAGTTGACAATCATGCAGGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005733.2-537s21c1
Sequence:CCGGCCGATGACGATGTCGTAGTTTCTCGAGAAACTACGACATCGTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)