EMAIL THIS PAGE TO A FRIEND

KIF20B

kinesin family member 20B

88 Gene Product Result for
Synonyms: CT90 KRMP1 MPHOSPH1 MPP-1 MPP1
Gene ID:
Mouse(240641) kinesin family member 20B
Rat(309523) kinesin family member 20B
sheep(101122564) kinesin family member 20B
Domestic Rabbit(100339334) kinesin family member 20B
domestic guinea pig(100729462) kinesin family member 20B
naked mole-rat(101717473) kinesin family member 20B
dog(477761) kinesin family member 20B
cow(514679) kinesin family member 20B
Horse(100062109) kinesin family member 20B
domestic cat(101080407) kinesin family member 20B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016195 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_193936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_193936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_193936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016195 Rosetta Predictions human pricing
NM_001107609 Rosetta Predictions rat pricing
NM_183046 Rosetta Predictions mouse pricing
XM_193936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128947 predicted 2290
2 SASI_Hs02_00349024 predicted 1567
3 SASI_Hs01_00128949 predicted 4122
4 SASI_Hs02_00349025 predicted 4855
5 SASI_Hs01_00128950 predicted 840
6 SASI_Hs02_00349026 predicted 2966
7 SASI_Hs01_00128951 predicted 5096
8 SASI_Hs02_00349027 predicted 2862
9 SASI_Hs01_00128953 predicted 3976
10 SASI_Hs01_00128955 predicted 4550
11 SASI_Hs01_00128946 predicted 2859
12 SASI_Hs01_00128948 predicted 2095
13 SASI_Hs01_00128952 predicted 2280
14 SASI_Hs01_00128954 predicted 3058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230525 predicted 1499
2 SASI_Rn02_00230526 predicted 3146
3 SASI_Rn02_00230527 predicted 2211
4 SASI_Rn02_00230528 predicted 1158
5 SASI_Rn02_00230529 predicted 4013
6 SASI_Rn02_00230530 predicted 3945
7 SASI_Rn02_00230531 predicted 1095
8 SASI_Rn02_00230532 predicted 2907
9 SASI_Rn02_00230533 predicted 2461
10 SASI_Rn02_00230534 predicted 2344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350054 predicted 1496
2 SASI_Mm02_00350055 predicted 1201
3 SASI_Mm02_00350056 predicted 261
4 SASI_Mm02_00350057 predicted 2073
5 SASI_Mm02_00350058 predicted 2479
6 SASI_Mm02_00350059 predicted 2729
7 SASI_Mm02_00350060 predicted 909
8 SASI_Mm02_00350061 predicted 4332
9 SASI_Mm02_00350062 predicted 2899
10 SASI_Mm02_00350063 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_193936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270433 predicted 2911
2 SASI_Mm01_00270434 predicted 1500
3 SASI_Mm01_00270435 predicted 3622
4 SASI_Mm01_00270436 predicted 3951
5 SASI_Mm01_00270437 predicted 2472
6 SASI_Mm01_00270438 predicted 2735
7 SASI_Mm01_00270439 predicted 3398
8 SASI_Mm01_00270440 predicted 4336
9 SASI_Mm01_00270441 predicted 2904
10 SASI_Mm01_00270442 predicted 3956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016195
VALIDATED
KIF20B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 20B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-2553s21c1
Sequence:CCGGGCGACCGAACATTGCAGAAATCTCGAGATTTCTGCAATGTTCGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016195.2-6123s1c1
Sequence:CCGGGCTATCAGATAGTAGATCATTCTCGAGAATGATCTACTATCTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016195.2-2554s1c1
Sequence:CCGGCGACCGAACATTGCAGAAATTCTCGAGAATTTCTGCAATGTTCGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016195.2-588s1c1
Sequence:CCGGGCCTCGAACTTTGAATGTATTCTCGAGAATACATTCAAAGTTCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016195.2-2553s1c1
Sequence:CCGGGCGACCGAACATTGCAGAAATCTCGAGATTTCTGCAATGTTCGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-589s21c1
Sequence:CCGGCCTCGAACTTTGAATGTATTACTCGAGTAATACATTCAAAGTTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-6123s21c1
Sequence:CCGGGCTATCAGATAGTAGATCATTCTCGAGAATGATCTACTATCTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016195.2-589s1c1
Sequence:CCGGCCTCGAACTTTGAATGTATTACTCGAGTAATACATTCAAAGTTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-5082s21c1
Sequence:CCGGACGGAGTCAGGCATCCATAATCTCGAGATTATGGATGCCTGACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016195.2-1117s21c1
Sequence:CCGGAGTAGAAGTCACAGCATATTCCTCGAGGAATATGCTGTGACTTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016195
VALIDATED
KIF20B MISSION shRNA shRNA Plasmid DNA
kinesin family member 20B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-2553s21c1
Sequence:CCGGGCGACCGAACATTGCAGAAATCTCGAGATTTCTGCAATGTTCGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016195.2-6123s1c1
Sequence:CCGGGCTATCAGATAGTAGATCATTCTCGAGAATGATCTACTATCTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016195.2-2554s1c1
Sequence:CCGGCGACCGAACATTGCAGAAATTCTCGAGAATTTCTGCAATGTTCGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016195.2-588s1c1
Sequence:CCGGGCCTCGAACTTTGAATGTATTCTCGAGAATACATTCAAAGTTCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016195.2-2553s1c1
Sequence:CCGGGCGACCGAACATTGCAGAAATCTCGAGATTTCTGCAATGTTCGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-589s21c1
Sequence:CCGGCCTCGAACTTTGAATGTATTACTCGAGTAATACATTCAAAGTTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-6123s21c1
Sequence:CCGGGCTATCAGATAGTAGATCATTCTCGAGAATGATCTACTATCTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016195.2-589s1c1
Sequence:CCGGCCTCGAACTTTGAATGTATTACTCGAGTAATACATTCAAAGTTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-5082s21c1
Sequence:CCGGACGGAGTCAGGCATCCATAATCTCGAGATTATGGATGCCTGACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016195.2-1117s21c1
Sequence:CCGGAGTAGAAGTCACAGCATATTCCTCGAGGAATATGCTGTGACTTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016195
VALIDATED
KIF20B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 20B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-2553s21c1
Sequence:CCGGGCGACCGAACATTGCAGAAATCTCGAGATTTCTGCAATGTTCGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016195.2-6123s1c1
Sequence:CCGGGCTATCAGATAGTAGATCATTCTCGAGAATGATCTACTATCTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016195.2-2554s1c1
Sequence:CCGGCGACCGAACATTGCAGAAATTCTCGAGAATTTCTGCAATGTTCGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016195.2-588s1c1
Sequence:CCGGGCCTCGAACTTTGAATGTATTCTCGAGAATACATTCAAAGTTCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016195.2-2553s1c1
Sequence:CCGGGCGACCGAACATTGCAGAAATCTCGAGATTTCTGCAATGTTCGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-589s21c1
Sequence:CCGGCCTCGAACTTTGAATGTATTACTCGAGTAATACATTCAAAGTTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-6123s21c1
Sequence:CCGGGCTATCAGATAGTAGATCATTCTCGAGAATGATCTACTATCTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016195.2-589s1c1
Sequence:CCGGCCTCGAACTTTGAATGTATTACTCGAGTAATACATTCAAAGTTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_016195.2-5082s21c1
Sequence:CCGGACGGAGTCAGGCATCCATAATCTCGAGATTATGGATGCCTGACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016195.2-1117s21c1
Sequence:CCGGAGTAGAAGTCACAGCATATTCCTCGAGGAATATGCTGTGACTTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_193936
VALIDATED
KIF20B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 20B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-4335s1c1
Sequence:CCGGGCTGATAGAAAGAAGTGGTTACTCGAGTAACCACTTCTTTCTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-1009s1c1
Sequence:CCGGCCCAAGATATAAAGGGCTATTCTCGAGAATAGCCCTTTATATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-880s1c1
Sequence:CCGGCCAGTCTGAATGTGGATAATACTCGAGTATTATCCACATTCAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-5251s1c1
Sequence:CCGGCGGTAGAAGTAAGTAAAGAAACTCGAGTTTCTTTACTTACTTCTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193936.3-5441s1c1
Sequence:CCGGAGACTGTTTCAGTGTAAAGTTCTCGAGAACTTTACACTGAAACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_193936
VALIDATED
KIF20B MISSION shRNA shRNA Plasmid DNA
kinesin family member 20B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-4335s1c1
Sequence:CCGGGCTGATAGAAAGAAGTGGTTACTCGAGTAACCACTTCTTTCTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-1009s1c1
Sequence:CCGGCCCAAGATATAAAGGGCTATTCTCGAGAATAGCCCTTTATATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-880s1c1
Sequence:CCGGCCAGTCTGAATGTGGATAATACTCGAGTATTATCCACATTCAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-5251s1c1
Sequence:CCGGCGGTAGAAGTAAGTAAAGAAACTCGAGTTTCTTTACTTACTTCTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193936.3-5441s1c1
Sequence:CCGGAGACTGTTTCAGTGTAAAGTTCTCGAGAACTTTACACTGAAACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_193936
VALIDATED
KIF20B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 20B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-4335s1c1
Sequence:CCGGGCTGATAGAAAGAAGTGGTTACTCGAGTAACCACTTCTTTCTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-1009s1c1
Sequence:CCGGCCCAAGATATAAAGGGCTATTCTCGAGAATAGCCCTTTATATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-880s1c1
Sequence:CCGGCCAGTCTGAATGTGGATAATACTCGAGTATTATCCACATTCAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193936.3-5251s1c1
Sequence:CCGGCGGTAGAAGTAAGTAAAGAAACTCGAGTTTCTTTACTTACTTCTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193936.3-5441s1c1
Sequence:CCGGAGACTGTTTCAGTGTAAAGTTCTCGAGAACTTTACACTGAAACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)