EMAIL THIS PAGE TO A FRIEND

KIF21A

kinesin family member 21A

147 Gene Product Result for
Synonyms: CFEOM1 FEOM1 FEOM3A
Gene ID:
Human(55605) Summary: This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Mouse(16564) kinesin family member 21A
Rat(300158) kinesin family member 21A
Zebrafish(566481) kinesin family member 21A
cow(540076) kinesin family member 21A
Horse(100070369) kinesin family member 21A
domestic cat(101095182) kinesin family member 21A
dog(100683402) kinesin family member 21A
chicken(417692) kinesin family member 21A
domestic guinea pig(100731180) kinesin family member 21A
naked mole-rat(101707979) kinesin family member 21A
sheep(101119971) kinesin family member 21A
Domestic Rabbit(100345420) kinesin family member 21A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV33932 Anti-KIF21A antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, rabbit, bovine, rat, mouse
western blot pricing
HPA058432 Anti-KIF21A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017641 Rosetta Predictions human pricing
NM_001106790 Rosetta Predictions rat pricing
NM_001109040 Rosetta Predictions mouse pricing
NM_001109041 Rosetta Predictions mouse pricing
NM_001109042 Rosetta Predictions mouse pricing
NM_016705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350334 predicted 4965
2 SASI_Hs01_00223633 predicted 5043
3 SASI_Hs01_00223634 predicted 2820
4 SASI_Hs01_00223635 predicted 2615
5 SASI_Hs01_00223636 predicted 2520
6 SASI_Hs01_00223637 predicted 4454
7 SASI_Hs01_00223638 predicted 4582
8 SASI_Hs02_00350335 predicted 4498
9 SASI_Hs01_00223640 predicted 1293
10 SASI_Hs01_00223641 predicted 4768
11 SASI_Hs01_00223639 predicted 4319
12 SASI_Hs01_00223642 predicted 2757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222428 predicted 537
2 SASI_Rn02_00222429 predicted 2041
3 SASI_Rn02_00222430 predicted 635
4 SASI_Rn02_00222431 predicted 2020
5 SASI_Rn02_00222432 predicted 2587
6 SASI_Rn02_00222433 predicted 2479
7 SASI_Rn02_00222434 predicted 289
8 SASI_Rn02_00222435 predicted 1327
9 SASI_Rn02_00222436 predicted 3522
10 SASI_Rn02_00222437 predicted 3133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304024 predicted 1295
2 SASI_Mm02_00304025 predicted 4420
3 SASI_Mm02_00304026 predicted 5238
4 SASI_Mm02_00304027 predicted 2767
5 SASI_Mm02_00304028 predicted 2393
6 SASI_Mm02_00304029 predicted 3313
7 SASI_Mm02_00304030 predicted 4840
8 SASI_Mm02_00304031 predicted 4852
9 SASI_Mm02_00304032 predicted 5343
10 SASI_Mm02_00304033 predicted 2701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304034 predicted 1301
2 SASI_Mm02_00304035 predicted 4294
3 SASI_Mm02_00304036 predicted 5111
4 SASI_Mm02_00304037 predicted 2732
5 SASI_Mm02_00304038 predicted 2349
6 SASI_Mm02_00304039 predicted 3272
7 SASI_Mm02_00304040 predicted 4713
8 SASI_Mm02_00304041 predicted 4720
9 SASI_Mm02_00304042 predicted 5213
10 SASI_Mm02_00304043 predicted 2667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304044 predicted 1303
2 SASI_Mm02_00304045 predicted 4106
3 SASI_Mm02_00304046 predicted 4930
4 SASI_Mm02_00304047 predicted 2724
5 SASI_Mm02_00304048 predicted 2357
6 SASI_Mm02_00304049 predicted 3269
7 SASI_Mm02_00304050 predicted 4527
8 SASI_Mm02_00304051 predicted 4538
9 SASI_Mm02_00304052 predicted 5035
10 SASI_Mm02_00304053 predicted 2666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143435 predicted 1296
2 SASI_Mm02_00323376 predicted 4942
3 SASI_Mm01_00143439 predicted 2732
4 SASI_Mm02_00323377 predicted 4655
5 SASI_Mm01_00143440 predicted 2348
6 SASI_Mm01_00143441 predicted 3269
7 SASI_Mm01_00143442 predicted 4550
8 SASI_Mm01_00143443 predicted 4557
9 SASI_Mm02_00323378 predicted 5046
10 SASI_Mm02_00323379 predicted 2669
11 SASI_Mm01_00143434 predicted 3316
12 SASI_Mm01_00143436 predicted 3868
13 SASI_Mm01_00143437 predicted 3534
14 SASI_Mm01_00143438 predicted 3548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017641
VALIDATED
KIF21A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 21A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017641.2-5163s1c1
Sequence:CCGGGCTGTGATAATACTCTGTATTCTCGAGAATACAGAGTATTATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017641.2-1451s1c1
Sequence:CCGGGCGTGTAAGAATTAAAGCCATCTCGAGATGGCTTTAATTCTTACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017641.2-583s1c1
Sequence:CCGGCCCAATTCTTAGAGCTCTATACTCGAGTATAGAGCTCTAAGAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017641.2-3129s1c1
Sequence:CCGGGCCAACATAATGCAGATGGAACTCGAGTTCCATCTGCATTATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017641.2-3946s1c1
Sequence:CCGGCCCGTAATGAACTGAATGTTTCTCGAGAAACATTCAGTTCATTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017641.2-1677s21c1
Sequence:CCGGACAGCAAGAGCGCCATATTTCCTCGAGGAAATATGGCGCTCTTGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017641.2-625s21c1
Sequence:CCGGTTGATACCACTCGTGATATTGCTCGAGCAATATCACGAGTGGTATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017641.2-2150s21c1
Sequence:CCGGGCTAATGATGCTGCAACATAACTCGAGTTATGTTGCAGCATCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017641
VALIDATED
KIF21A MISSION shRNA shRNA Plasmid DNA
kinesin family member 21A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017641.2-5163s1c1
Sequence:CCGGGCTGTGATAATACTCTGTATTCTCGAGAATACAGAGTATTATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017641.2-1451s1c1
Sequence:CCGGGCGTGTAAGAATTAAAGCCATCTCGAGATGGCTTTAATTCTTACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017641.2-583s1c1
Sequence:CCGGCCCAATTCTTAGAGCTCTATACTCGAGTATAGAGCTCTAAGAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017641.2-3129s1c1
Sequence:CCGGGCCAACATAATGCAGATGGAACTCGAGTTCCATCTGCATTATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017641.2-3946s1c1
Sequence:CCGGCCCGTAATGAACTGAATGTTTCTCGAGAAACATTCAGTTCATTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017641.2-1677s21c1
Sequence:CCGGACAGCAAGAGCGCCATATTTCCTCGAGGAAATATGGCGCTCTTGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017641.2-625s21c1
Sequence:CCGGTTGATACCACTCGTGATATTGCTCGAGCAATATCACGAGTGGTATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017641.2-2150s21c1
Sequence:CCGGGCTAATGATGCTGCAACATAACTCGAGTTATGTTGCAGCATCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017641
VALIDATED
KIF21A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 21A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017641.2-5163s1c1
Sequence:CCGGGCTGTGATAATACTCTGTATTCTCGAGAATACAGAGTATTATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017641.2-1451s1c1
Sequence:CCGGGCGTGTAAGAATTAAAGCCATCTCGAGATGGCTTTAATTCTTACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017641.2-583s1c1
Sequence:CCGGCCCAATTCTTAGAGCTCTATACTCGAGTATAGAGCTCTAAGAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017641.2-3129s1c1
Sequence:CCGGGCCAACATAATGCAGATGGAACTCGAGTTCCATCTGCATTATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017641.2-3946s1c1
Sequence:CCGGCCCGTAATGAACTGAATGTTTCTCGAGAAACATTCAGTTCATTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017641.2-1677s21c1
Sequence:CCGGACAGCAAGAGCGCCATATTTCCTCGAGGAAATATGGCGCTCTTGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017641.2-625s21c1
Sequence:CCGGTTGATACCACTCGTGATATTGCTCGAGCAATATCACGAGTGGTATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017641.2-2150s21c1
Sequence:CCGGGCTAATGATGCTGCAACATAACTCGAGTTATGTTGCAGCATCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016705
VALIDATED
KIF21A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 21A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016705.1-850s1c1
Sequence:CCGGCGCAACTGATAATAAGCTGATCTCGAGATCAGCTTATTATCAGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016705.1-1997s1c1
Sequence:CCGGGCTAACTATCAAGCCGACTTACTCGAGTAAGTCGGCTTGATAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016705.1-3242s1c1
Sequence:CCGGGCCCAGAAAGAGGCTCAAATTCTCGAGAATTTGAGCCTCTTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016705.1-3243s1c1
Sequence:CCGGCCCAGAAAGAGGCTCAAATTACTCGAGTAATTTGAGCCTCTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016705.1-4427s1c1
Sequence:CCGGCCTCATTATGATGGGATAGAACTCGAGTTCTATCCCATCATAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-3379s21c1
Sequence:CCGGGCCCAGAAAGAGGCTCAAATTCTCGAGAATTTGAGCCTCTTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-1922s21c1
Sequence:CCGGTTGCCGGGAAAGACGATAATGCTCGAGCATTATCGTCTTTCCCGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-5073s21c1
Sequence:CCGGCTCAATCCATGGCTAGATAATCTCGAGATTATCTAGCCATGGATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-987s21c1
Sequence:CCGGCGCAACTGATAATAAGCTGATCTCGAGATCAGCTTATTATCAGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-2134s21c1
Sequence:CCGGGCTAACTATCAAGCCGACTTACTCGAGTAAGTCGGCTTGATAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016705
VALIDATED
KIF21A MISSION shRNA shRNA Plasmid DNA
kinesin family member 21A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016705.1-850s1c1
Sequence:CCGGCGCAACTGATAATAAGCTGATCTCGAGATCAGCTTATTATCAGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016705.1-1997s1c1
Sequence:CCGGGCTAACTATCAAGCCGACTTACTCGAGTAAGTCGGCTTGATAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016705.1-3242s1c1
Sequence:CCGGGCCCAGAAAGAGGCTCAAATTCTCGAGAATTTGAGCCTCTTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016705.1-3243s1c1
Sequence:CCGGCCCAGAAAGAGGCTCAAATTACTCGAGTAATTTGAGCCTCTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016705.1-4427s1c1
Sequence:CCGGCCTCATTATGATGGGATAGAACTCGAGTTCTATCCCATCATAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-3379s21c1
Sequence:CCGGGCCCAGAAAGAGGCTCAAATTCTCGAGAATTTGAGCCTCTTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-1922s21c1
Sequence:CCGGTTGCCGGGAAAGACGATAATGCTCGAGCATTATCGTCTTTCCCGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-5073s21c1
Sequence:CCGGCTCAATCCATGGCTAGATAATCTCGAGATTATCTAGCCATGGATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-987s21c1
Sequence:CCGGCGCAACTGATAATAAGCTGATCTCGAGATCAGCTTATTATCAGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-2134s21c1
Sequence:CCGGGCTAACTATCAAGCCGACTTACTCGAGTAAGTCGGCTTGATAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016705
VALIDATED
KIF21A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 21A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016705.1-850s1c1
Sequence:CCGGCGCAACTGATAATAAGCTGATCTCGAGATCAGCTTATTATCAGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016705.1-1997s1c1
Sequence:CCGGGCTAACTATCAAGCCGACTTACTCGAGTAAGTCGGCTTGATAGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016705.1-3242s1c1
Sequence:CCGGGCCCAGAAAGAGGCTCAAATTCTCGAGAATTTGAGCCTCTTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016705.1-3243s1c1
Sequence:CCGGCCCAGAAAGAGGCTCAAATTACTCGAGTAATTTGAGCCTCTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016705.1-4427s1c1
Sequence:CCGGCCTCATTATGATGGGATAGAACTCGAGTTCTATCCCATCATAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-3379s21c1
Sequence:CCGGGCCCAGAAAGAGGCTCAAATTCTCGAGAATTTGAGCCTCTTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-1922s21c1
Sequence:CCGGTTGCCGGGAAAGACGATAATGCTCGAGCATTATCGTCTTTCCCGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-5073s21c1
Sequence:CCGGCTCAATCCATGGCTAGATAATCTCGAGATTATCTAGCCATGGATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-987s21c1
Sequence:CCGGCGCAACTGATAATAAGCTGATCTCGAGATCAGCTTATTATCAGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016705.3-2134s21c1
Sequence:CCGGGCTAACTATCAAGCCGACTTACTCGAGTAAGTCGGCTTGATAGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)