EMAIL THIS PAGE TO A FRIEND

KIF21B

kinesin family member 21B

123 Gene Product Result for
UniProtKB ID: O75037, B2RP62, B7ZMI0, Q5T4J3
Gene ID:
Human(23046) Summary: This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(16565) kinesin family member 21B
Rat(289397) kinesin family member 21B
sheep(101108506) kinesin family member 21B
domestic guinea pig(100726962) kinesin family member 21B
naked mole-rat(101726598) kinesin family member 21B
Zebrafish(570502) kinesin family member 21B
chicken(421178) kinesin family member 21B
cow(100337196) kinesin family member 21B
Horse(100063175) kinesin family member 21B
domestic cat(101098602) kinesin family member 21B
dog(490245) kinesin family member 21B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017596 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056981 MISSION® esiRNA esiRNA human KIF21B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017596 Rosetta Predictions human pricing
NM_001105990 Rosetta Predictions rat pricing
NM_001039472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192895 predicted 2872
2 SASI_Hs01_00192896 predicted 3095
3 SASI_Hs01_00192897 predicted 4056
4 SASI_Hs01_00192898 predicted 3074
5 SASI_Hs01_00192899 predicted 1253
6 SASI_Hs01_00192901 predicted 3271
7 SASI_Hs01_00192902 predicted 3776
8 SASI_Hs01_00192903 predicted 461
9 SASI_Hs01_00192904 predicted 1774
10 SASI_Hs02_00350268 predicted 4065
11 SASI_Hs01_00192900 predicted 4365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214542 predicted 2388
2 SASI_Rn02_00214543 predicted 3045
3 SASI_Rn02_00214544 predicted 2452
4 SASI_Rn02_00214545 predicted 441
5 SASI_Rn02_00214546 predicted 596
6 SASI_Rn02_00214547 predicted 3100
7 SASI_Rn02_00214548 predicted 3597
8 SASI_Rn02_00214549 predicted 1916
9 SASI_Rn02_00214550 predicted 4344
10 SASI_Rn02_00214551 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290058 predicted 3081
2 SASI_Mm02_00290059 predicted 464
3 SASI_Mm02_00290060 predicted 611
4 SASI_Mm02_00290061 predicted 3108
5 SASI_Mm02_00290062 predicted 3133
6 SASI_Mm02_00290063 predicted 1257
7 SASI_Mm02_00290064 predicted 550
8 SASI_Mm02_00290065 predicted 4674
9 SASI_Mm02_00290066 predicted 535
10 SASI_Mm02_00290067 predicted 865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039472
KIF21B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 21B
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000431345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039472.1-2435s21c1
Sequence:CCGGACAAGATAAAGGCAGATTATGCTCGAGCATAATCTGCCTTTATCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039472.1-3137s21c1
Sequence:CCGGCTGATATGGAGCGTCTCATAACTCGAGTTATGAGACGCTCCATATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039472
KIF21B MISSION shRNA shRNA Plasmid DNA
kinesin family member 21B
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000431345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039472.1-2435s21c1
Sequence:CCGGACAAGATAAAGGCAGATTATGCTCGAGCATAATCTGCCTTTATCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039472.1-3137s21c1
Sequence:CCGGCTGATATGGAGCGTCTCATAACTCGAGTTATGAGACGCTCCATATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039472
KIF21B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 21B
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000431345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039472.1-2435s21c1
Sequence:CCGGACAAGATAAAGGCAGATTATGCTCGAGCATAATCTGCCTTTATCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039472.1-3137s21c1
Sequence:CCGGCTGATATGGAGCGTCTCATAACTCGAGTTATGAGACGCTCCATATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017596
KIF21B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 21B
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000257703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017596.2-1506s21c1
Sequence:CCGGATGGAGCTGATGGAGTATAAGCTCGAGCTTATACTCCATCAGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017596.2-537s21c1
Sequence:CCGGGGCTGCTTCGAGGGCTATAATCTCGAGATTATAGCCCTCGAAGCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017596
KIF21B MISSION shRNA shRNA Plasmid DNA
kinesin family member 21B
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000257703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017596.2-1506s21c1
Sequence:CCGGATGGAGCTGATGGAGTATAAGCTCGAGCTTATACTCCATCAGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017596.2-537s21c1
Sequence:CCGGGGCTGCTTCGAGGGCTATAATCTCGAGATTATAGCCCTCGAAGCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017596
KIF21B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 21B
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000257703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017596.2-1506s21c1
Sequence:CCGGATGGAGCTGATGGAGTATAAGCTCGAGCTTATACTCCATCAGCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017596.2-537s21c1
Sequence:CCGGGGCTGCTTCGAGGGCTATAATCTCGAGATTATAGCCCTCGAAGCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019962
KIF21B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 21B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-4811s1c1
Sequence:CCGGCCTCACTATGATGGTATTGAACTCGAGTTCAATACCATCATAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-3691s1c1
Sequence:CCGGCCACGATGACTTCAAGTTCAACTCGAGTTGAACTTGAAGTCATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-3088s1c1
Sequence:CCGGGCAGAGAATGACCATCGTCAACTCGAGTTGACGATGGTCATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019962.2-7938s1c1
Sequence:CCGGGCCTTTAACAACCAGAGTATACTCGAGTATACTCTGGTTGTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-5128s1c1
Sequence:CCGGCCGGGTAAAGCTGTGGAATTACTCGAGTAATTCCACAGCTTTACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019962
KIF21B MISSION shRNA shRNA Plasmid DNA
kinesin family member 21B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-4811s1c1
Sequence:CCGGCCTCACTATGATGGTATTGAACTCGAGTTCAATACCATCATAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-3691s1c1
Sequence:CCGGCCACGATGACTTCAAGTTCAACTCGAGTTGAACTTGAAGTCATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-3088s1c1
Sequence:CCGGGCAGAGAATGACCATCGTCAACTCGAGTTGACGATGGTCATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019962.2-7938s1c1
Sequence:CCGGGCCTTTAACAACCAGAGTATACTCGAGTATACTCTGGTTGTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-5128s1c1
Sequence:CCGGCCGGGTAAAGCTGTGGAATTACTCGAGTAATTCCACAGCTTTACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019962
KIF21B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 21B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-4811s1c1
Sequence:CCGGCCTCACTATGATGGTATTGAACTCGAGTTCAATACCATCATAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-3691s1c1
Sequence:CCGGCCACGATGACTTCAAGTTCAACTCGAGTTGAACTTGAAGTCATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-3088s1c1
Sequence:CCGGGCAGAGAATGACCATCGTCAACTCGAGTTGACGATGGTCATTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019962.2-7938s1c1
Sequence:CCGGGCCTTTAACAACCAGAGTATACTCGAGTATACTCTGGTTGTTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019962.2-5128s1c1
Sequence:CCGGCCGGGTAAAGCTGTGGAATTACTCGAGTAATTCCACAGCTTTACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)