EMAIL THIS PAGE TO A FRIEND

KIF22

kinesin family member 22

60 Gene Product Result for
Synonyms: A-328A3.2 KID KNSL4 OBP OBP-1 OBP-2 SEMDJL2
Gene ID:
Human(3835) Summary: The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(110033) kinesin family member 22
Rat(293502) kinesin family member 22
Zebrafish(561788) kinesin family member 22
domestic cat(101095786) kinesin family member 22
cow(506294) kinesin family member 22
dog(489938) kinesin family member 22
domestic guinea pig(100735136) kinesin family member 22
naked mole-rat(101716422) kinesin family member 22
sheep(101120211) kinesin family member 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011171 MISSION® esiRNA esiRNA targeting mouse Kif22 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007317 Rosetta Predictions human pricing
NM_001009645 Rosetta Predictions rat pricing
NM_145588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191984 predicted 876
2 SASI_Hs01_00191985 predicted 552
3 SASI_Hs01_00191986 predicted 877
4 SASI_Hs02_00343389 predicted 1173
5 SASI_Hs02_00343390 predicted 1654
6 SASI_Hs02_00343391 predicted 1851
7 SASI_Hs01_00191988 predicted 839
8 SASI_Hs02_00343392 predicted 1457
9 SASI_Hs02_00343393 predicted 1064
10 SASI_Hs02_00343394 predicted 1497
11 SASI_Hs01_00191987 predicted 528
12 SASI_Hs01_00191989 predicted 282
13 SASI_Hs01_00191990 predicted 840
14 SASI_Hs01_00191991 predicted 608
15 SASI_Hs01_00191992 predicted 434
16 SASI_Hs01_00191993 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083570 predicted 1630
2 SASI_Rn01_00083571 predicted 1049
3 SASI_Rn01_00083572 predicted 1140
4 SASI_Rn01_00083573 predicted 1270
5 SASI_Rn01_00083574 predicted 1094
6 SASI_Rn01_00083575 predicted 393
7 SASI_Rn02_00199668 predicted 457
8 SASI_Rn01_00083576 predicted 671
9 SASI_Rn01_00083577 predicted 424
10 SASI_Rn01_00083579 predicted 258
11 SASI_Rn01_00083578 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134728 predicted 1027
2 SASI_Mm01_00134729 predicted 1282
3 SASI_Mm02_00341124 predicted 502
4 SASI_Mm01_00134730 predicted 1100
5 SASI_Mm01_00134731 predicted 1072
6 SASI_Mm01_00134732 predicted 679
7 SASI_Mm01_00134733 predicted 434
8 SASI_Mm01_00134735 predicted 894
9 SASI_Mm01_00134736 predicted 1028
10 SASI_Mm02_00341125 predicted 1117
11 SASI_Mm01_00134734 predicted 1283
12 SASI_Mm01_00134737 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007317
VALIDATED
KIF22 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 22
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007317.1-1461s1c1
Sequence:CCGGCCTAGAGATTGAGAGGCTTAACTCGAGTTAAGCCTCTCAATCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007317.1-1459s1c1
Sequence:CCGGGACCTAGAGATTGAGAGGCTTCTCGAGAAGCCTCTCAATCTCTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007317.1-1308s1c1
Sequence:CCGGCCTACAGAAGCTAAGCAGCATCTCGAGATGCTGCTTAGCTTCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007317.1-267s1c1
Sequence:CCGGCCACCAGGAGACTCTCAAATACTCGAGTATTTGAGAGTCTCCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007317.1-1038s1c1
Sequence:CCGGCAGTATCCTTATTGCCAACATCTCGAGATGTTGGCAATAAGGATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-1088s21c1
Sequence:CCGGCAGTCTCCGCACTCAACTTTGCTCGAGCAAAGTTGAGTGCGGAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-942s21c1
Sequence:CCGGAGTGGTAGATGCGCTGAATCACTCGAGTGATTCAGCGCATCTACCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-317s21c1
Sequence:CCGGGTACTCAGCAGGACATCTATGCTCGAGCATAGATGTCCTGCTGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-1115s21c1
Sequence:CCGGGGTCCAAGGAGGTGATCAATCCTCGAGGATTGATCACCTCCTTGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-879s21c1
Sequence:CCGGCAACAAGGGCCTTCGGCTAAACTCGAGTTTAGCCGAAGGCCCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-104s21c1
Sequence:CCGGGCTGTCGGCTAAGCAAGATTGCTCGAGCAATCTTGCTTAGCCGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-991s21c1
Sequence:CCGGAGCAAGCTCACTCGCCTATTGCTCGAGCAATAGGCGAGTGAGCTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007317
VALIDATED
KIF22 MISSION shRNA shRNA Plasmid DNA
kinesin family member 22
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007317.1-1461s1c1
Sequence:CCGGCCTAGAGATTGAGAGGCTTAACTCGAGTTAAGCCTCTCAATCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007317.1-1459s1c1
Sequence:CCGGGACCTAGAGATTGAGAGGCTTCTCGAGAAGCCTCTCAATCTCTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007317.1-1308s1c1
Sequence:CCGGCCTACAGAAGCTAAGCAGCATCTCGAGATGCTGCTTAGCTTCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007317.1-267s1c1
Sequence:CCGGCCACCAGGAGACTCTCAAATACTCGAGTATTTGAGAGTCTCCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007317.1-1038s1c1
Sequence:CCGGCAGTATCCTTATTGCCAACATCTCGAGATGTTGGCAATAAGGATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-1088s21c1
Sequence:CCGGCAGTCTCCGCACTCAACTTTGCTCGAGCAAAGTTGAGTGCGGAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-942s21c1
Sequence:CCGGAGTGGTAGATGCGCTGAATCACTCGAGTGATTCAGCGCATCTACCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-317s21c1
Sequence:CCGGGTACTCAGCAGGACATCTATGCTCGAGCATAGATGTCCTGCTGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-1115s21c1
Sequence:CCGGGGTCCAAGGAGGTGATCAATCCTCGAGGATTGATCACCTCCTTGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-879s21c1
Sequence:CCGGCAACAAGGGCCTTCGGCTAAACTCGAGTTTAGCCGAAGGCCCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-104s21c1
Sequence:CCGGGCTGTCGGCTAAGCAAGATTGCTCGAGCAATCTTGCTTAGCCGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-991s21c1
Sequence:CCGGAGCAAGCTCACTCGCCTATTGCTCGAGCAATAGGCGAGTGAGCTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007317
VALIDATED
KIF22 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 22
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007317.1-1461s1c1
Sequence:CCGGCCTAGAGATTGAGAGGCTTAACTCGAGTTAAGCCTCTCAATCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007317.1-1459s1c1
Sequence:CCGGGACCTAGAGATTGAGAGGCTTCTCGAGAAGCCTCTCAATCTCTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007317.1-1308s1c1
Sequence:CCGGCCTACAGAAGCTAAGCAGCATCTCGAGATGCTGCTTAGCTTCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007317.1-267s1c1
Sequence:CCGGCCACCAGGAGACTCTCAAATACTCGAGTATTTGAGAGTCTCCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007317.1-1038s1c1
Sequence:CCGGCAGTATCCTTATTGCCAACATCTCGAGATGTTGGCAATAAGGATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-1088s21c1
Sequence:CCGGCAGTCTCCGCACTCAACTTTGCTCGAGCAAAGTTGAGTGCGGAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-942s21c1
Sequence:CCGGAGTGGTAGATGCGCTGAATCACTCGAGTGATTCAGCGCATCTACCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-317s21c1
Sequence:CCGGGTACTCAGCAGGACATCTATGCTCGAGCATAGATGTCCTGCTGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-1115s21c1
Sequence:CCGGGGTCCAAGGAGGTGATCAATCCTCGAGGATTGATCACCTCCTTGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-879s21c1
Sequence:CCGGCAACAAGGGCCTTCGGCTAAACTCGAGTTTAGCCGAAGGCCCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-104s21c1
Sequence:CCGGGCTGTCGGCTAAGCAAGATTGCTCGAGCAATCTTGCTTAGCCGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007317.1-991s21c1
Sequence:CCGGAGCAAGCTCACTCGCCTATTGCTCGAGCAATAGGCGAGTGAGCTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145588
VALIDATED
KIF22 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 22
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-1060s1c1
Sequence:CCGGCCAGGATACAATTTCAGCATTCTCGAGAATGCTGAAATTGTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-1157s1c1
Sequence:CCGGCCTGTTAAGCTGTCTCAGAAACTCGAGTTTCTGAGACAGCTTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-773s1c1
Sequence:CCGGCGTGAACGTTTGACTCCATTTCTCGAGAAATGGAGTCAAACGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-257s1c1
Sequence:CCGGACGCTCAAATATCAGTTTGATCTCGAGATCAAACTGATATTTGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-1285s1c1
Sequence:CCGGCCTCTTACAGAAGCTAAGCAACTCGAGTTGCTTAGCTTCTGTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-1285s21c1
Sequence:CCGGCCTCTTACAGAAGCTAAGCAACTCGAGTTGCTTAGCTTCTGTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-1060s21c1
Sequence:CCGGCCAGGATACAATTTCAGCATTCTCGAGAATGCTGAAATTGTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-1157s21c1
Sequence:CCGGCCTGTTAAGCTGTCTCAGAAACTCGAGTTTCTGAGACAGCTTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-773s21c1
Sequence:CCGGCGTGAACGTTTGACTCCATTTCTCGAGAAATGGAGTCAAACGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145588
VALIDATED
KIF22 MISSION shRNA shRNA Plasmid DNA
kinesin family member 22
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-1060s1c1
Sequence:CCGGCCAGGATACAATTTCAGCATTCTCGAGAATGCTGAAATTGTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-1157s1c1
Sequence:CCGGCCTGTTAAGCTGTCTCAGAAACTCGAGTTTCTGAGACAGCTTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-773s1c1
Sequence:CCGGCGTGAACGTTTGACTCCATTTCTCGAGAAATGGAGTCAAACGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-257s1c1
Sequence:CCGGACGCTCAAATATCAGTTTGATCTCGAGATCAAACTGATATTTGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-1285s1c1
Sequence:CCGGCCTCTTACAGAAGCTAAGCAACTCGAGTTGCTTAGCTTCTGTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-1285s21c1
Sequence:CCGGCCTCTTACAGAAGCTAAGCAACTCGAGTTGCTTAGCTTCTGTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-1060s21c1
Sequence:CCGGCCAGGATACAATTTCAGCATTCTCGAGAATGCTGAAATTGTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-1157s21c1
Sequence:CCGGCCTGTTAAGCTGTCTCAGAAACTCGAGTTTCTGAGACAGCTTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-773s21c1
Sequence:CCGGCGTGAACGTTTGACTCCATTTCTCGAGAAATGGAGTCAAACGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145588
VALIDATED
KIF22 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 22
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-1060s1c1
Sequence:CCGGCCAGGATACAATTTCAGCATTCTCGAGAATGCTGAAATTGTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-1157s1c1
Sequence:CCGGCCTGTTAAGCTGTCTCAGAAACTCGAGTTTCTGAGACAGCTTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-773s1c1
Sequence:CCGGCGTGAACGTTTGACTCCATTTCTCGAGAAATGGAGTCAAACGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-257s1c1
Sequence:CCGGACGCTCAAATATCAGTTTGATCTCGAGATCAAACTGATATTTGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145588.1-1285s1c1
Sequence:CCGGCCTCTTACAGAAGCTAAGCAACTCGAGTTGCTTAGCTTCTGTAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-1285s21c1
Sequence:CCGGCCTCTTACAGAAGCTAAGCAACTCGAGTTGCTTAGCTTCTGTAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-1060s21c1
Sequence:CCGGCCAGGATACAATTTCAGCATTCTCGAGAATGCTGAAATTGTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-1157s21c1
Sequence:CCGGCCTGTTAAGCTGTCTCAGAAACTCGAGTTTCTGAGACAGCTTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145588.1-773s21c1
Sequence:CCGGCGTGAACGTTTGACTCCATTTCTCGAGAAATGGAGTCAAACGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)