EMAIL THIS PAGE TO A FRIEND

KIF23

kinesin family member 23

147 Gene Product Result for
Synonyms: CHO1 KNSL5 MKLP-1 MKLP1
UniProtKB ID: Q02241, Q8WVP0
Gene ID:
Human(9493) Summary: The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in two transcript variants encoding two different isoforms. [provided by RefSeq, Jul 2008]
Mouse(71819) kinesin family member 23
Rat(315740) kinesin family member 23
sheep(101114023) kinesin family member 23
Domestic Rabbit(100343765) kinesin family member 23
domestic guinea pig(100714156) kinesin family member 23
naked mole-rat(101701407) kinesin family member 23
Zebrafish(30627) kinesin family member 23
chicken(415567) kinesin family member 23
cow(515748) kinesin family member 23
domestic cat(101098230) kinesin family member 23
Horse(100064697) kinesin family member 23
dog(478355) kinesin family member 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004856 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004856 Rosetta Predictions human pricing
NM_138555 Rosetta Predictions human pricing
NM_001108155 Rosetta Predictions rat pricing
NM_024245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102541 predicted 2502
2 SASI_Hs01_00102542 predicted 1263
3 SASI_Hs01_00102543 predicted 1601
4 SASI_Hs02_00338458 predicted 1542
5 SASI_Hs02_00338459 predicted 1513
6 SASI_Hs02_00338460 predicted 1240
7 SASI_Hs01_00102546 predicted 1624
8 SASI_Hs01_00102548 predicted 1212
9 SASI_Hs01_00102549 predicted 594
10 SASI_Hs02_00338461 predicted 2574
11 SASI_Hs01_00102540 predicted 694
12 SASI_Hs01_00102544 predicted 479
13 SASI_Hs01_00102545 predicted 2480
14 SASI_Hs01_00102547 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240237 predicted 2813
2 SASI_Hs01_00240238 predicted 1256
3 SASI_Hs01_00240239 predicted 1601
4 SASI_Hs02_00363698 predicted 1549
5 SASI_Hs02_00363699 predicted 1510
6 SASI_Hs02_00363700 predicted 1235
7 SASI_Hs01_00240242 predicted 1619
8 SASI_Hs01_00240244 predicted 1205
9 SASI_Hs01_00240245 predicted 595
10 SASI_Hs02_00363701 predicted 2885
11 SASI_Hs01_00240236 predicted 690
12 SASI_Hs01_00240240 predicted 476
13 SASI_Hs01_00240241 predicted 2785
14 SASI_Hs01_00240243 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235894 predicted 307
2 SASI_Rn02_00235895 predicted 949
3 SASI_Rn02_00235896 predicted 2909
4 SASI_Rn02_00235897 predicted 2478
5 SASI_Rn02_00235898 predicted 2438
6 SASI_Rn02_00235899 predicted 1243
7 SASI_Rn02_00235900 predicted 286
8 SASI_Rn02_00235901 predicted 742
9 SASI_Rn02_00235902 predicted 2014
10 SASI_Rn02_00235903 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139513 predicted 860
2 SASI_Mm01_00139514 predicted 2321
3 SASI_Mm02_00327623 predicted 1163
4 SASI_Mm01_00139515 predicted 1272
5 SASI_Mm01_00139519 predicted 2808
6 SASI_Mm01_00139520 predicted 411
7 SASI_Mm01_00139521 predicted 2778
8 SASI_Mm01_00139522 predicted 1635
9 SASI_Mm02_00327624 predicted 1156
10 SASI_Mm02_00327625 predicted 1218
11 SASI_Mm01_00139516 predicted 2059
12 SASI_Mm01_00139517 predicted 800
13 SASI_Mm01_00139518 predicted 1876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024245
VALIDATED
KIF23 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 23
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-1317s21c1
Sequence:CCGGCCATCTATTCAAGAACTACTTCTCGAGAAGTAGTTCTTGAATAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-1697s21c1
Sequence:CCGGTAGCTTTCAAGGCCTTATTAACTCGAGTTAATAAGGCCTTGAAAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-352s21c1
Sequence:CCGGTACTCATTCAAGCGGGTATTTCTCGAGAAATACCCGCTTGAATGAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-640s21c1
Sequence:CCGGGCCTTGTTAGAACGGCAGAAACTCGAGTTTCTGCCGTTCTAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-2771s21c1
Sequence:CCGGGCGGACAATCGGTTCAGTTTACTCGAGTAAACTGAACCGATTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-3007s1c1
Sequence:CCGGCCCGTCACCAGAAGACCGTTTCTCGAGAAACGGTCTTCTGGTGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-640s1c1
Sequence:CCGGGCCTTGTTAGAACGGCAGAAACTCGAGTTTCTGCCGTTCTAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-1317s1c1
Sequence:CCGGCCATCTATTCAAGAACTACTTCTCGAGAAGTAGTTCTTGAATAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-2921s1c1
Sequence:CCGGCCGTTGAAATGAGAGCAGGATCTCGAGATCCTGCTCTCATTTCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-2771s1c1
Sequence:CCGGGCGGACAATCGGTTCAGTTTACTCGAGTAAACTGAACCGATTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024245
VALIDATED
KIF23 MISSION shRNA shRNA Plasmid DNA
kinesin family member 23
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-1317s21c1
Sequence:CCGGCCATCTATTCAAGAACTACTTCTCGAGAAGTAGTTCTTGAATAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-1697s21c1
Sequence:CCGGTAGCTTTCAAGGCCTTATTAACTCGAGTTAATAAGGCCTTGAAAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-352s21c1
Sequence:CCGGTACTCATTCAAGCGGGTATTTCTCGAGAAATACCCGCTTGAATGAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-640s21c1
Sequence:CCGGGCCTTGTTAGAACGGCAGAAACTCGAGTTTCTGCCGTTCTAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-2771s21c1
Sequence:CCGGGCGGACAATCGGTTCAGTTTACTCGAGTAAACTGAACCGATTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-3007s1c1
Sequence:CCGGCCCGTCACCAGAAGACCGTTTCTCGAGAAACGGTCTTCTGGTGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-640s1c1
Sequence:CCGGGCCTTGTTAGAACGGCAGAAACTCGAGTTTCTGCCGTTCTAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-1317s1c1
Sequence:CCGGCCATCTATTCAAGAACTACTTCTCGAGAAGTAGTTCTTGAATAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-2921s1c1
Sequence:CCGGCCGTTGAAATGAGAGCAGGATCTCGAGATCCTGCTCTCATTTCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-2771s1c1
Sequence:CCGGGCGGACAATCGGTTCAGTTTACTCGAGTAAACTGAACCGATTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024245
VALIDATED
KIF23 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 23
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-1317s21c1
Sequence:CCGGCCATCTATTCAAGAACTACTTCTCGAGAAGTAGTTCTTGAATAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-1697s21c1
Sequence:CCGGTAGCTTTCAAGGCCTTATTAACTCGAGTTAATAAGGCCTTGAAAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-352s21c1
Sequence:CCGGTACTCATTCAAGCGGGTATTTCTCGAGAAATACCCGCTTGAATGAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-640s21c1
Sequence:CCGGGCCTTGTTAGAACGGCAGAAACTCGAGTTTCTGCCGTTCTAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024245.3-2771s21c1
Sequence:CCGGGCGGACAATCGGTTCAGTTTACTCGAGTAAACTGAACCGATTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-3007s1c1
Sequence:CCGGCCCGTCACCAGAAGACCGTTTCTCGAGAAACGGTCTTCTGGTGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-640s1c1
Sequence:CCGGGCCTTGTTAGAACGGCAGAAACTCGAGTTTCTGCCGTTCTAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-1317s1c1
Sequence:CCGGCCATCTATTCAAGAACTACTTCTCGAGAAGTAGTTCTTGAATAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-2921s1c1
Sequence:CCGGCCGTTGAAATGAGAGCAGGATCTCGAGATCCTGCTCTCATTTCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024245.3-2771s1c1
Sequence:CCGGGCGGACAATCGGTTCAGTTTACTCGAGTAAACTGAACCGATTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004856
VALIDATED
KIF23 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 23
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-1626s21c1
Sequence:CCGGACGACATAACTTACGACAAATCTCGAGATTTGTCGTAAGTTATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-400s21c1
Sequence:CCGGCCCTTGGTCAATGACCTCATTCTCGAGAATGAGGTCATTGACCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-2585s21c1
Sequence:CCGGCCGATGTAGAAACAAGGTGTTCTCGAGAACACCTTGTTTCTACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-1177s21c1
Sequence:CCGGTTACGTGAAGCTGGTAATATTCTCGAGAATATTACCAGCTTCACGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-3027s21c1
Sequence:CCGGATGATTAAGGAAGACTATATCCTCGAGGATATAGTCTTCCTTAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004856.4-3123s1c1
Sequence:CCGGGCTATTTATTAGCTGCAAGAACTCGAGTTCTTGCAGCTAATAAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004856.4-2585s1c1
Sequence:CCGGCCGATGTAGAAACAAGGTGTTCTCGAGAACACCTTGTTTCTACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004856.4-400s1c1
Sequence:CCGGCCCTTGGTCAATGACCTCATTCTCGAGAATGAGGTCATTGACCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004856.4-622s1c1
Sequence:CCGGGCCTTATTAGAACGTCAGAAACTCGAGTTTCTGACGTTCTAATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004856.4-2037s1c1
Sequence:CCGGGCAGAATAAACTCTGGGTTAACTCGAGTTAACCCAGAGTTTATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004856
VALIDATED
KIF23 MISSION shRNA shRNA Plasmid DNA
kinesin family member 23
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-1626s21c1
Sequence:CCGGACGACATAACTTACGACAAATCTCGAGATTTGTCGTAAGTTATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-400s21c1
Sequence:CCGGCCCTTGGTCAATGACCTCATTCTCGAGAATGAGGTCATTGACCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-2585s21c1
Sequence:CCGGCCGATGTAGAAACAAGGTGTTCTCGAGAACACCTTGTTTCTACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-1177s21c1
Sequence:CCGGTTACGTGAAGCTGGTAATATTCTCGAGAATATTACCAGCTTCACGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-3027s21c1
Sequence:CCGGATGATTAAGGAAGACTATATCCTCGAGGATATAGTCTTCCTTAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004856.4-3123s1c1
Sequence:CCGGGCTATTTATTAGCTGCAAGAACTCGAGTTCTTGCAGCTAATAAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004856.4-2585s1c1
Sequence:CCGGCCGATGTAGAAACAAGGTGTTCTCGAGAACACCTTGTTTCTACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004856.4-400s1c1
Sequence:CCGGCCCTTGGTCAATGACCTCATTCTCGAGAATGAGGTCATTGACCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004856.4-622s1c1
Sequence:CCGGGCCTTATTAGAACGTCAGAAACTCGAGTTTCTGACGTTCTAATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004856.4-2037s1c1
Sequence:CCGGGCAGAATAAACTCTGGGTTAACTCGAGTTAACCCAGAGTTTATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004856
VALIDATED
KIF23 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 23
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-1626s21c1
Sequence:CCGGACGACATAACTTACGACAAATCTCGAGATTTGTCGTAAGTTATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-400s21c1
Sequence:CCGGCCCTTGGTCAATGACCTCATTCTCGAGAATGAGGTCATTGACCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-2585s21c1
Sequence:CCGGCCGATGTAGAAACAAGGTGTTCTCGAGAACACCTTGTTTCTACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-1177s21c1
Sequence:CCGGTTACGTGAAGCTGGTAATATTCTCGAGAATATTACCAGCTTCACGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004856.4-3027s21c1
Sequence:CCGGATGATTAAGGAAGACTATATCCTCGAGGATATAGTCTTCCTTAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004856.4-3123s1c1
Sequence:CCGGGCTATTTATTAGCTGCAAGAACTCGAGTTCTTGCAGCTAATAAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004856.4-2585s1c1
Sequence:CCGGCCGATGTAGAAACAAGGTGTTCTCGAGAACACCTTGTTTCTACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004856.4-400s1c1
Sequence:CCGGCCCTTGGTCAATGACCTCATTCTCGAGAATGAGGTCATTGACCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004856.4-622s1c1
Sequence:CCGGGCCTTATTAGAACGTCAGAAACTCGAGTTTCTGACGTTCTAATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004856.4-2037s1c1
Sequence:CCGGGCAGAATAAACTCTGGGTTAACTCGAGTTAACCCAGAGTTTATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)