EMAIL THIS PAGE TO A FRIEND

KIF24

kinesin family member 24

69 Gene Product Result for
Synonyms: C9orf48 bA571F15.4
Gene ID:
Human(347240) Summary: Kinesins, such as KIF24, are microtubule-dependent ATPases that function as molecular motors. They play important roles in intracellular vesicle transport and cell division (summary by Venturelli et al., 2010 [PubMed 20670673]
Mouse(109242) kinesin family member 24
Rat(313170) kinesin family member 24
chicken(427398) kinesin family member 24
cow(513392) kinesin family member 24
Horse(100068535) kinesin family member 24
domestic cat(101090399) kinesin family member 24
dog(481585) kinesin family member 24
domestic guinea pig(100721248) kinesin family member 24
naked mole-rat(101699156) kinesin family member 24
sheep(101123527) kinesin family member 24
Domestic Rabbit(100343439) kinesin family member 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194313 Rosetta Predictions human pricing
XM_001068422 Rosetta Predictions rat pricing
XM_232902 Rosetta Predictions rat pricing
NM_024241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015625 predicted 2363
2 SASI_Hs02_00371447 predicted 1715
3 SASI_Hs02_00371448 predicted 633
4 SASI_Hs02_00371449 predicted 1733
5 SASI_Hs01_00015628 predicted 2929
6 SASI_Hs01_00015629 predicted 3745
7 SASI_Hs02_00371450 predicted 696
8 SASI_Hs01_00015630 predicted 2572
9 SASI_Hs02_00371451 predicted 1004
10 SASI_Hs02_00371452 predicted 535
11 SASI_Hs01_00015626 predicted 2435
12 SASI_Hs01_00015627 predicted 2597
13 SASI_Hs01_00015631 predicted 1442
14 SASI_Hs01_00015632 predicted 1365
15 SASI_Hs01_00015633 predicted 2130
16 SASI_Hs01_00015634 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324437 predicted 1175
2 SASI_Rn02_00324438 predicted 1220
3 SASI_Rn02_00324439 predicted 3342
4 SASI_Rn02_00324440 predicted 3821
5 SASI_Rn02_00324441 predicted 2069
6 SASI_Rn02_00324442 predicted 3403
7 SASI_Rn02_00324443 predicted 3829
8 SASI_Rn02_00324444 predicted 990
9 SASI_Rn02_00324445 predicted 1467
10 SASI_Rn02_00324446 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387314 predicted 1173
2 SASI_Rn02_00387315 predicted 1223
3 SASI_Rn02_00387316 predicted 3350
4 SASI_Rn02_00387317 predicted 3830
5 SASI_Rn02_00387318 predicted 2068
6 SASI_Rn02_00387319 predicted 3406
7 SASI_Rn02_00387320 predicted 3832
8 SASI_Rn02_00387321 predicted 994
9 SASI_Rn02_00387322 predicted 1460
10 SASI_Rn02_00387323 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327610 predicted 1223
2 SASI_Mm02_00327611 predicted 992
3 SASI_Mm02_00327612 predicted 1239
4 SASI_Mm02_00327613 predicted 496
5 SASI_Mm02_00327614 predicted 722
6 SASI_Mm02_00327615 predicted 668
7 SASI_Mm02_00327616 predicted 1171
8 SASI_Mm02_00327617 predicted 3619
9 SASI_Mm02_00327618 predicted 2561
10 SASI_Mm02_00327619 predicted 1106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194313
KIF24 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 24
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-363s1c1
Sequence:CCGGGCACCTAAGGTCTCTGGTAAACTCGAGTTTACCAGAGACCTTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-2490s1c1
Sequence:CCGGGATGAAATCATGGTTCTGAAACTCGAGTTTCAGAACCATGATTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194313.1-3712s1c1
Sequence:CCGGCCCATTACTATGTGAGCCTTTCTCGAGAAAGGCTCACATAGTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-120s1c1
Sequence:CCGGCGGGTCAAAGAACTAAAGAAACTCGAGTTTCTTTAGTTCTTTGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-491s1c1
Sequence:CCGGAGCACCATTGTGCTCTGAGAACTCGAGTTCTCAGAGCACAATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194313.2-995s21c1
Sequence:CCGGAGACTACTCACCCACTTATTCCTCGAGGAATAAGTGGGTGAGTAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194313.2-667s21c1
Sequence:CCGGGATTGTGATATTCCCATTATTCTCGAGAATAATGGGAATATCACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194313
KIF24 MISSION shRNA shRNA Plasmid DNA
kinesin family member 24
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-363s1c1
Sequence:CCGGGCACCTAAGGTCTCTGGTAAACTCGAGTTTACCAGAGACCTTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-2490s1c1
Sequence:CCGGGATGAAATCATGGTTCTGAAACTCGAGTTTCAGAACCATGATTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194313.1-3712s1c1
Sequence:CCGGCCCATTACTATGTGAGCCTTTCTCGAGAAAGGCTCACATAGTAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-120s1c1
Sequence:CCGGCGGGTCAAAGAACTAAAGAAACTCGAGTTTCTTTAGTTCTTTGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-491s1c1
Sequence:CCGGAGCACCATTGTGCTCTGAGAACTCGAGTTCTCAGAGCACAATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194313.2-995s21c1
Sequence:CCGGAGACTACTCACCCACTTATTCCTCGAGGAATAAGTGGGTGAGTAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194313.2-667s21c1
Sequence:CCGGGATTGTGATATTCCCATTATTCTCGAGAATAATGGGAATATCACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194313
KIF24 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 24
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-363s1c1
Sequence:CCGGGCACCTAAGGTCTCTGGTAAACTCGAGTTTACCAGAGACCTTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-2490s1c1
Sequence:CCGGGATGAAATCATGGTTCTGAAACTCGAGTTTCAGAACCATGATTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194313.1-3712s1c1
Sequence:CCGGCCCATTACTATGTGAGCCTTTCTCGAGAAAGGCTCACATAGTAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-120s1c1
Sequence:CCGGCGGGTCAAAGAACTAAAGAAACTCGAGTTTCTTTAGTTCTTTGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194313.1-491s1c1
Sequence:CCGGAGCACCATTGTGCTCTGAGAACTCGAGTTCTCAGAGCACAATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194313.2-995s21c1
Sequence:CCGGAGACTACTCACCCACTTATTCCTCGAGGAATAAGTGGGTGAGTAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194313.2-667s21c1
Sequence:CCGGGATTGTGATATTCCCATTATTCTCGAGAATAATGGGAATATCACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145101
KIF24 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-454s1c1
Sequence:CCGGACCAGAATCTTCTGCGGCAAACTCGAGTTTGCCGCAGAAGATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-631s1c1
Sequence:CCGGCGGACGTGTCACTCCCTGATTCTCGAGAATCAGGGAGTGACACGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-727s1c1
Sequence:CCGGGCGCAGATTATTTGTTTACCACTCGAGTGGTAAACAAATAATCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-404s1c1
Sequence:CCGGCCAATTGTTATTCGACGCGTTCTCGAGAACGCGTCGAATAACAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-690s1c1
Sequence:CCGGGCAGAGCACAAGTAGTCATAACTCGAGTTATGACTACTTGTGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145101
KIF24 MISSION shRNA shRNA Plasmid DNA
kinesin family member 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-454s1c1
Sequence:CCGGACCAGAATCTTCTGCGGCAAACTCGAGTTTGCCGCAGAAGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-631s1c1
Sequence:CCGGCGGACGTGTCACTCCCTGATTCTCGAGAATCAGGGAGTGACACGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-727s1c1
Sequence:CCGGGCGCAGATTATTTGTTTACCACTCGAGTGGTAAACAAATAATCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-404s1c1
Sequence:CCGGCCAATTGTTATTCGACGCGTTCTCGAGAACGCGTCGAATAACAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-690s1c1
Sequence:CCGGGCAGAGCACAAGTAGTCATAACTCGAGTTATGACTACTTGTGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145101
KIF24 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-454s1c1
Sequence:CCGGACCAGAATCTTCTGCGGCAAACTCGAGTTTGCCGCAGAAGATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-631s1c1
Sequence:CCGGCGGACGTGTCACTCCCTGATTCTCGAGAATCAGGGAGTGACACGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-727s1c1
Sequence:CCGGGCGCAGATTATTTGTTTACCACTCGAGTGGTAAACAAATAATCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-404s1c1
Sequence:CCGGCCAATTGTTATTCGACGCGTTCTCGAGAACGCGTCGAATAACAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145101.1-690s1c1
Sequence:CCGGGCAGAGCACAAGTAGTCATAACTCGAGTTATGACTACTTGTGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)