EMAIL THIS PAGE TO A FRIEND

KIF25

kinesin family member 25

36 Gene Product Result for
Synonyms: KNSL3
UniProtKB ID: Q9UIL4, O94775, Q5SZU9
Gene ID:
Human(3834) Summary: The protein encoded by this gene is a member of the kinesin-like protein family. Protein family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. However, the particular function of this gene product has not yet been determined. Two alternatively spliced transcript variants which encode products have been described. Other splice variants have been found that lack exon 2 and the initiation codon for translation. [provided by RefSeq, Jul 2008]
sheep(101116060) kinesin family member 25
domestic guinea pig(100720413) kinesin family member 25
naked mole-rat(101722705) kinesin family member 25
chicken(421563) kinesin family member 25
dog(100685956) kinesin family member 25
domestic cat(101081637) kinesin family member 25
cow(616884) kinesin family member 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030615 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066101 MISSION® esiRNA esiRNA human KIF25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005355 Rosetta Predictions human pricing
NM_030615 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339441 predicted 453
2 SASI_Hs01_00245970 predicted 273
3 SASI_Hs01_00245972 predicted 835
4 SASI_Hs01_00245977 predicted 343
5 SASI_Hs01_00245973 predicted 516
6 SASI_Hs01_00245975 predicted 369
7 SASI_Hs01_00245976 predicted 594
8 SASI_Hs01_00245978 predicted 426
9 SASI_Hs02_00339442 predicted 462
10 SASI_Hs02_00339443 predicted 770
11 SASI_Hs01_00245971 predicted 804
12 SASI_Hs01_00245974 predicted 342
13 SASI_Hs01_00245979 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358172 predicted 448
2 SASI_Hs01_00235386 predicted 269
3 SASI_Hs01_00235388 predicted 831
4 SASI_Hs01_00235393 predicted 348
5 SASI_Hs01_00235389 predicted 521
6 SASI_Hs01_00235391 predicted 371
7 SASI_Hs01_00235392 predicted 590
8 SASI_Hs01_00235394 predicted 422
9 SASI_Hs02_00358173 predicted 459
10 SASI_Hs02_00358174 predicted 767
11 SASI_Hs01_00235387 predicted 797
12 SASI_Hs01_00235390 predicted 336
13 SASI_Hs01_00235395 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030615
KIF25 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 25
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030615.2-539s21c1
Sequence:CCGGGACTTAGGAATTATCCCTAGACTCGAGTCTAGGGATAATTCCTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030615.2-653s21c1
Sequence:CCGCTTTGACCTTCTGGCCAAAGACCTCGAGGTCTTTGGCCAGAAGGTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-608s1c1
Sequence:CCGGCCAAAGGTTGAAGTCTCCATACTCGAGTATGGAGACTTCAACCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-624s1c1
Sequence:CCGGCCATAGTGGAAGTTTACAATACTCGAGTATTGTAAACTTCCACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-407s1c1
Sequence:CCGGCTACTCACTTCTCTCTTGGATCTCGAGATCCAAGAGAGAAGTGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-849s1c1
Sequence:CCGGCCAGGTCTCACCTGATAATTACTCGAGTAATTATCAGGTGAGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030615.2-778s21c1
Sequence:CCGGACTGATGGAGCTCGTTCATGGCTCGAGCCATGAACGAGCTCCATCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-1252s1c1
Sequence:CCGGCGATGCGAAGTTACTGGTGATCTCGAGATCACCAGTAACTTCGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030615
KIF25 MISSION shRNA shRNA Plasmid DNA
kinesin family member 25
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030615.2-539s21c1
Sequence:CCGGGACTTAGGAATTATCCCTAGACTCGAGTCTAGGGATAATTCCTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030615.2-653s21c1
Sequence:CCGCTTTGACCTTCTGGCCAAAGACCTCGAGGTCTTTGGCCAGAAGGTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-608s1c1
Sequence:CCGGCCAAAGGTTGAAGTCTCCATACTCGAGTATGGAGACTTCAACCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-624s1c1
Sequence:CCGGCCATAGTGGAAGTTTACAATACTCGAGTATTGTAAACTTCCACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-407s1c1
Sequence:CCGGCTACTCACTTCTCTCTTGGATCTCGAGATCCAAGAGAGAAGTGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-849s1c1
Sequence:CCGGCCAGGTCTCACCTGATAATTACTCGAGTAATTATCAGGTGAGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030615.2-778s21c1
Sequence:CCGGACTGATGGAGCTCGTTCATGGCTCGAGCCATGAACGAGCTCCATCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-1252s1c1
Sequence:CCGGCGATGCGAAGTTACTGGTGATCTCGAGATCACCAGTAACTTCGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030615
KIF25 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 25
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030615.2-539s21c1
Sequence:CCGGGACTTAGGAATTATCCCTAGACTCGAGTCTAGGGATAATTCCTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030615.2-653s21c1
Sequence:CCGCTTTGACCTTCTGGCCAAAGACCTCGAGGTCTTTGGCCAGAAGGTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-608s1c1
Sequence:CCGGCCAAAGGTTGAAGTCTCCATACTCGAGTATGGAGACTTCAACCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-624s1c1
Sequence:CCGGCCATAGTGGAAGTTTACAATACTCGAGTATTGTAAACTTCCACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-407s1c1
Sequence:CCGGCTACTCACTTCTCTCTTGGATCTCGAGATCCAAGAGAGAAGTGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-849s1c1
Sequence:CCGGCCAGGTCTCACCTGATAATTACTCGAGTAATTATCAGGTGAGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030615.2-778s21c1
Sequence:CCGGACTGATGGAGCTCGTTCATGGCTCGAGCCATGAACGAGCTCCATCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030615.1-1252s1c1
Sequence:CCGGCGATGCGAAGTTACTGGTGATCTCGAGATCACCAGTAACTTCGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)