EMAIL THIS PAGE TO A FRIEND

KIF26A

kinesin family member 26A

91 Gene Product Result for
UniProtKB ID: Q9ULI4, Q8TAZ7, Q96GK3, Q9UFL3
Gene ID:
Mouse(668303) kinesin family member 26A
Rat(314473) kinesin family member 26A
Zebrafish(561709) kinesin family member 26A
chicken(423489) kinesin family member 26A
cow(100337486) kinesin family member 26A
Horse(100060810) kinesin family member 26A
domestic cat(101086658) kinesin family member 26A
dog(490875) kinesin family member 26A
domestic guinea pig(100724158) kinesin family member 26A
naked mole-rat(101698290) kinesin family member 26A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015656 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001097621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001097621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001097621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015656 Rosetta Predictions human pricing
XM_050278 Rosetta Predictions human pricing
XM_234565 Rosetta Predictions rat pricing
NM_001097621 Rosetta Predictions mouse pricing
XM_138275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348266 predicted 5491
2 SASI_Hs02_00348267 predicted 3028
3 SASI_Hs02_00348268 predicted 4769
4 SASI_Hs02_00348269 predicted 4678
5 SASI_Hs02_00348270 predicted 2425
6 SASI_Hs02_00348271 predicted 4546
7 SASI_Hs02_00348272 predicted 2348
8 SASI_Hs02_00348273 predicted 4310
9 SASI_Hs02_00348274 predicted 3063
10 SASI_Hs02_00348275 predicted 4541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_050278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295639 predicted 5244
2 SASI_Hs01_00295640 predicted 5312
3 SASI_Hs01_00295641 predicted 5498
4 SASI_Hs01_00295642 predicted 5449
5 SASI_Hs01_00295643 predicted 5317
6 SASI_Hs01_00295644 predicted 5492
7 SASI_Hs01_00295645 predicted 5376
8 SASI_Hs01_00295646 predicted 5450
9 SASI_Hs01_00295647 predicted 5312
10 SASI_Hs01_00295648 predicted 5372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388569 predicted 4233
2 SASI_Rn02_00388570 predicted 3842
3 SASI_Rn02_00388571 predicted 4381
4 SASI_Rn02_00388572 predicted 3376
5 SASI_Rn02_00388573 predicted 3337
6 SASI_Rn02_00388574 predicted 1255
7 SASI_Rn02_00388575 predicted 1230
8 SASI_Rn02_00388576 predicted 5364
9 SASI_Rn02_00388577 predicted 1325
10 SASI_Rn02_00388578 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301176 predicted 1853
2 SASI_Mm02_00301177 predicted 1261
3 SASI_Mm02_00301178 predicted 1632
4 SASI_Mm02_00301179 predicted 2208
5 SASI_Mm02_00301180 predicted 1534
6 SASI_Mm02_00301181 predicted 3374
7 SASI_Mm02_00301182 predicted 3938
8 SASI_Mm02_00301183 predicted 5722
9 SASI_Mm02_00301184 predicted 4805
10 SASI_Mm02_00301185 predicted 4403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276526 predicted 1859
2 SASI_Mm01_00276527 predicted 1264
3 SASI_Mm01_00276528 predicted 1640
4 SASI_Mm01_00276529 predicted 3382
5 SASI_Mm01_00276530 predicted 2209
6 SASI_Mm01_00276531 predicted 1541
7 SASI_Mm01_00276532 predicted 1305
8 SASI_Mm01_00276533 predicted 3375
9 SASI_Mm01_00276534 predicted 3946
10 SASI_Mm01_00276535 predicted 4806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015656
KIF26A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 26A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000247680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015656.1-6384s21c1
Sequence:CCGGAGGTTCTGTTAGGTTCATATTCTCGAGAATATGAACCTAACAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015656.1-903s21c1
Sequence:CCGGTGCAGCCTCCTTCTTCATAAGCTCGAGCTTATGAAGAAGGAGGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015656.1-3230s21c1
Sequence:CCGGGCAGCATCAATGATGAGTTTGCTCGAGCAAACTCATCATTGATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015656.1-1271s21c1
Sequence:CCGGCTGCAGTTCCCAAGATGTTTGCTCGAGCAAACATCTTGGGAACTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015656
KIF26A MISSION shRNA shRNA Plasmid DNA
kinesin family member 26A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000247680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015656.1-6384s21c1
Sequence:CCGGAGGTTCTGTTAGGTTCATATTCTCGAGAATATGAACCTAACAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015656.1-903s21c1
Sequence:CCGGTGCAGCCTCCTTCTTCATAAGCTCGAGCTTATGAAGAAGGAGGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015656.1-3230s21c1
Sequence:CCGGGCAGCATCAATGATGAGTTTGCTCGAGCAAACTCATCATTGATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015656.1-1271s21c1
Sequence:CCGGCTGCAGTTCCCAAGATGTTTGCTCGAGCAAACATCTTGGGAACTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015656
KIF26A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 26A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000247680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015656.1-6384s21c1
Sequence:CCGGAGGTTCTGTTAGGTTCATATTCTCGAGAATATGAACCTAACAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015656.1-903s21c1
Sequence:CCGGTGCAGCCTCCTTCTTCATAAGCTCGAGCTTATGAAGAAGGAGGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015656.1-3230s21c1
Sequence:CCGGGCAGCATCAATGATGAGTTTGCTCGAGCAAACTCATCATTGATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015656.1-1271s21c1
Sequence:CCGGCTGCAGTTCCCAAGATGTTTGCTCGAGCAAACATCTTGGGAACTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097621
KIF26A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 26A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-3363s21c1
Sequence:CCGGGTAGCATCAATGACGAGTTTGCTCGAGCAAACTCGTCATTGATGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-4823s21c1
Sequence:CCGGCATAGCCGTGTCCACGAATTGCTCGAGCAATTCGTGGACACGGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097621.1-6018s21c1
Sequence:CCGGACGCAAGTGCCTTTAACTTTGCTCGAGCAAAGTTAAAGGCACTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-1241s21c1
Sequence:CCGGTTCGGAAAGGTGAAGGTTATGCTCGAGCATAACCTTCACCTTTCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-5372s21c1
Sequence:CCGGGAGATCAAGGTGTACGAAATACTCGAGTATTTCGTACACCTTGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097621
KIF26A MISSION shRNA shRNA Plasmid DNA
kinesin family member 26A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-3363s21c1
Sequence:CCGGGTAGCATCAATGACGAGTTTGCTCGAGCAAACTCGTCATTGATGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-4823s21c1
Sequence:CCGGCATAGCCGTGTCCACGAATTGCTCGAGCAATTCGTGGACACGGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097621.1-6018s21c1
Sequence:CCGGACGCAAGTGCCTTTAACTTTGCTCGAGCAAAGTTAAAGGCACTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-1241s21c1
Sequence:CCGGTTCGGAAAGGTGAAGGTTATGCTCGAGCATAACCTTCACCTTTCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-5372s21c1
Sequence:CCGGGAGATCAAGGTGTACGAAATACTCGAGTATTTCGTACACCTTGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097621
KIF26A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 26A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-3363s21c1
Sequence:CCGGGTAGCATCAATGACGAGTTTGCTCGAGCAAACTCGTCATTGATGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-4823s21c1
Sequence:CCGGCATAGCCGTGTCCACGAATTGCTCGAGCAATTCGTGGACACGGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097621.1-6018s21c1
Sequence:CCGGACGCAAGTGCCTTTAACTTTGCTCGAGCAAAGTTAAAGGCACTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-1241s21c1
Sequence:CCGGTTCGGAAAGGTGAAGGTTATGCTCGAGCATAACCTTCACCTTTCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097621.1-5372s21c1
Sequence:CCGGGAGATCAAGGTGTACGAAATACTCGAGTATTTCGTACACCTTGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)