EMAIL THIS PAGE TO A FRIEND

KIF27

kinesin family member 27

69 Gene Product Result for
UniProtKB ID: Q86VH2, B2RTR8, Q5T6W0, Q86VH0, Q86VH1, Q9UF54
Gene ID:
Human(55582) Summary: This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
Mouse(75050) kinesin family member 27
Rat(246209) kinesin family member 27
chicken(427456) kinesin family member 27
cow(536335) kinesin family member 27
Horse(100052685) kinesin family member 27
domestic cat(101099408) kinesin family member 27
dog(484148) kinesin family member 27
domestic guinea pig(100729388) kinesin family member 27
naked mole-rat(101717500) kinesin family member 27
sheep(101118416) kinesin family member 27
Domestic Rabbit(100355239) kinesin family member 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017576 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017576 Rosetta Predictions human pricing
NM_198050 Rosetta Predictions rat pricing
NM_175214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198966 predicted 3069
2 SASI_Hs01_00198968 predicted 1983
3 SASI_Hs01_00198969 predicted 1970
4 SASI_Hs02_00350231 predicted 715
5 SASI_Hs01_00198971 predicted 3575
6 SASI_Hs01_00198972 predicted 1450
7 SASI_Hs01_00198973 predicted 347
8 SASI_Hs01_00198975 predicted 239
9 SASI_Hs02_00350232 predicted 2642
10 SASI_Hs02_00350233 predicted 4080
11 SASI_Hs01_00198967 predicted 3130
12 SASI_Hs01_00198970 predicted 1913
13 SASI_Hs01_00198974 predicted 2323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105673 predicted 865
2 SASI_Rn01_00105674 predicted 2272
3 SASI_Rn01_00105675 predicted 550
4 SASI_Rn01_00105676 predicted 1729
5 SASI_Rn01_00105677 predicted 2353
6 SASI_Rn01_00105678 predicted 3661
7 SASI_Rn02_00269911 predicted 3429
8 SASI_Rn01_00105679 predicted 1014
9 SASI_Rn01_00105680 predicted 3060
10 SASI_Rn01_00105681 predicted 438
11 SASI_Rn01_00105682 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062855 predicted 1730
2 SASI_Mm01_00062856 predicted 2135
3 SASI_Mm01_00062857 predicted 3295
4 SASI_Mm01_00062858 predicted 2424
5 SASI_Mm01_00062859 predicted 3265
6 SASI_Mm02_00345891 predicted 770
7 SASI_Mm01_00062860 predicted 321
8 SASI_Mm01_00062861 predicted 2211
9 SASI_Mm01_00062862 predicted 2461
10 SASI_Mm01_00062864 predicted 689
11 SASI_Mm01_00062863 predicted 3574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017576
KIF27 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 27
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017576.1-4419s1c1
Sequence:CCGGGCTCAAGTTCACTACCTCTTTCTCGAGAAAGAGGTAGTGAACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-919s1c1
Sequence:CCGGGAACGGTTCAAAGAATCCATTCTCGAGAATGGATTCTTTGAACCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-922s1c1
Sequence:CCGGCGGTTCAAAGAATCCATTCAACTCGAGTTGAATGGATTCTTTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-1503s1c1
Sequence:CCGGCCTCACCTCATTTCGAGGAATCTCGAGATTCCTCGAAATGAGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-2168s1c1
Sequence:CCGGCCCTTGTTGAATTGAGTGATACTCGAGTATCACTCAATTCAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017576.1-4147s21c1
Sequence:CCGGAGTCGACTGTCATCCCAAATTCTCGAGAATTTGGGATGACAGTCGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017576.1-3564s21c1
Sequence:CCGGAGTTCTGGAACGGGATAATATCTCGAGATATTATCCCGTTCCAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017576
KIF27 MISSION shRNA shRNA Plasmid DNA
kinesin family member 27
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017576.1-4419s1c1
Sequence:CCGGGCTCAAGTTCACTACCTCTTTCTCGAGAAAGAGGTAGTGAACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-919s1c1
Sequence:CCGGGAACGGTTCAAAGAATCCATTCTCGAGAATGGATTCTTTGAACCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-922s1c1
Sequence:CCGGCGGTTCAAAGAATCCATTCAACTCGAGTTGAATGGATTCTTTGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-1503s1c1
Sequence:CCGGCCTCACCTCATTTCGAGGAATCTCGAGATTCCTCGAAATGAGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-2168s1c1
Sequence:CCGGCCCTTGTTGAATTGAGTGATACTCGAGTATCACTCAATTCAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017576.1-4147s21c1
Sequence:CCGGAGTCGACTGTCATCCCAAATTCTCGAGAATTTGGGATGACAGTCGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017576.1-3564s21c1
Sequence:CCGGAGTTCTGGAACGGGATAATATCTCGAGATATTATCCCGTTCCAGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017576
KIF27 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 27
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017576.1-4419s1c1
Sequence:CCGGGCTCAAGTTCACTACCTCTTTCTCGAGAAAGAGGTAGTGAACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-919s1c1
Sequence:CCGGGAACGGTTCAAAGAATCCATTCTCGAGAATGGATTCTTTGAACCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-922s1c1
Sequence:CCGGCGGTTCAAAGAATCCATTCAACTCGAGTTGAATGGATTCTTTGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-1503s1c1
Sequence:CCGGCCTCACCTCATTTCGAGGAATCTCGAGATTCCTCGAAATGAGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017576.1-2168s1c1
Sequence:CCGGCCCTTGTTGAATTGAGTGATACTCGAGTATCACTCAATTCAACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017576.1-4147s21c1
Sequence:CCGGAGTCGACTGTCATCCCAAATTCTCGAGAATTTGGGATGACAGTCGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017576.1-3564s21c1
Sequence:CCGGAGTTCTGGAACGGGATAATATCTCGAGATATTATCCCGTTCCAGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175214
KIF27 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-2611s1c1
Sequence:CCGGGCAGAAATTAAGAGAGATCAACTCGAGTTGATCTCTCTTAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-1063s1c1
Sequence:CCGGCGAATGGATGAAATGGAATTTCTCGAGAAATTCCATTTCATCCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-4073s1c1
Sequence:CCGGGCAGAGAATTACGTCAGATTTCTCGAGAAATCTGACGTAATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-1282s1c1
Sequence:CCGGGCTGTCAAACTAAATCAGAAACTCGAGTTTCTGATTTAGTTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-3382s1c1
Sequence:CCGGCGTAAACAACAGTTGCAGAATCTCGAGATTCTGCAACTGTTGTTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175214
KIF27 MISSION shRNA shRNA Plasmid DNA
kinesin family member 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-2611s1c1
Sequence:CCGGGCAGAAATTAAGAGAGATCAACTCGAGTTGATCTCTCTTAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-1063s1c1
Sequence:CCGGCGAATGGATGAAATGGAATTTCTCGAGAAATTCCATTTCATCCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-4073s1c1
Sequence:CCGGGCAGAGAATTACGTCAGATTTCTCGAGAAATCTGACGTAATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-1282s1c1
Sequence:CCGGGCTGTCAAACTAAATCAGAAACTCGAGTTTCTGATTTAGTTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-3382s1c1
Sequence:CCGGCGTAAACAACAGTTGCAGAATCTCGAGATTCTGCAACTGTTGTTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175214
KIF27 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-2611s1c1
Sequence:CCGGGCAGAAATTAAGAGAGATCAACTCGAGTTGATCTCTCTTAATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-1063s1c1
Sequence:CCGGCGAATGGATGAAATGGAATTTCTCGAGAAATTCCATTTCATCCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-4073s1c1
Sequence:CCGGGCAGAGAATTACGTCAGATTTCTCGAGAAATCTGACGTAATTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-1282s1c1
Sequence:CCGGGCTGTCAAACTAAATCAGAAACTCGAGTTTCTGATTTAGTTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175214.3-3382s1c1
Sequence:CCGGCGTAAACAACAGTTGCAGAATCTCGAGATTCTGCAACTGTTGTTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)