EMAIL THIS PAGE TO A FRIEND

KIF2A

kinesin heavy chain member 2A

190 Gene Product Result for
Synonyms: HK2 KIF2
Gene ID:
Human(3796) Summary: The protein encoded by this gene is a plus end-directed motor required for normal mitotic progression. The encoded protein is required for normal spindle activity during mitosis and is necessary for normal brain development. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(16563) kinesin family member 2A
Rat(84391) kinesin heavy chain member 2A
sheep(101107307) kinesin heavy chain member 2A
domestic guinea pig(100722495) kinesin heavy chain member 2A
naked mole-rat(101722153) kinesin heavy chain member 2A
chicken(427156) kinesin heavy chain member 2A
domestic cat(101099932) kinesin heavy chain member 2A
cow(768014) kinesin heavy chain member 2A
Horse(100050982) kinesin heavy chain member 2A
dog(478071) kinesin heavy chain member 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004520 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098511 Rosetta Predictions human pricing
NM_004520 Rosetta Predictions human pricing
XM_001057533 Rosetta Predictions rat pricing
XM_001065116 Rosetta Predictions rat pricing
XM_001065173 Rosetta Predictions rat pricing
XM_001065230 Rosetta Predictions rat pricing
XM_345150 Rosetta Predictions rat pricing
NM_008442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319177 predicted 2405
2 SASI_Hs02_00319178 predicted 1570
3 SASI_Hs02_00319179 predicted 1625
4 SASI_Hs02_00319180 predicted 2573
5 SASI_Hs02_00319181 predicted 2321
6 SASI_Hs02_00319182 predicted 2354
7 SASI_Hs02_00319183 predicted 1402
8 SASI_Hs02_00319184 predicted 1519
9 SASI_Hs02_00319185 predicted 1231
10 SASI_Hs02_00319186 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204548 predicted 2297
2 SASI_Hs01_00204549 predicted 1563
3 SASI_Hs01_00204550 predicted 1627
4 SASI_Hs02_00337801 predicted 1169
5 SASI_Hs01_00204551 predicted 2462
6 SASI_Hs01_00204552 predicted 2206
7 SASI_Hs01_00204553 predicted 2241
8 SASI_Hs02_00337802 predicted 1401
9 SASI_Hs02_00337803 predicted 1518
10 SASI_Hs01_00204555 predicted 1233
11 SASI_Hs01_00204554 predicted 812
12 SASI_Hs01_00204556 predicted 1884
13 SASI_Hs01_00204557 predicted 2015
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286706 predicted 1023
2 SASI_Rn02_00286707 predicted 1077
3 SASI_Rn02_00286708 predicted 1926
4 SASI_Rn02_00286709 predicted 1267
5 SASI_Rn02_00286710 predicted 1899
6 SASI_Rn02_00286711 predicted 1012
7 SASI_Rn02_00286712 predicted 1471
8 SASI_Rn02_00286713 predicted 2117
9 SASI_Rn02_00286714 predicted 1668
10 SASI_Rn02_00286715 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312942 predicted 1078
2 SASI_Rn02_00312943 predicted 1977
3 SASI_Rn02_00312944 predicted 1320
4 SASI_Rn02_00312945 predicted 1952
5 SASI_Rn02_00312946 predicted 2137
6 SASI_Rn02_00312947 predicted 2121
7 SASI_Rn02_00312948 predicted 1066
8 SASI_Rn02_00312949 predicted 1529
9 SASI_Rn02_00312950 predicted 1814
10 SASI_Rn02_00312951 predicted 2049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313131 predicted 1079
2 SASI_Rn02_00313132 predicted 2098
3 SASI_Rn02_00313133 predicted 2069
4 SASI_Rn02_00313134 predicted 1656
5 SASI_Rn02_00313135 predicted 1066
6 SASI_Rn02_00313136 predicted 1526
7 SASI_Rn02_00313137 predicted 2286
8 SASI_Rn02_00313138 predicted 1931
9 SASI_Rn02_00313139 predicted 1003
10 SASI_Rn02_00313140 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313328 predicted 1019
2 SASI_Rn02_00313329 predicted 1071
3 SASI_Rn02_00313330 predicted 1922
4 SASI_Rn02_00313331 predicted 1262
5 SASI_Rn02_00313332 predicted 1895
6 SASI_Rn02_00313333 predicted 1011
7 SASI_Rn02_00313334 predicted 1473
8 SASI_Rn02_00313335 predicted 2116
9 SASI_Rn02_00313336 predicted 1673
10 SASI_Rn02_00313337 predicted 1752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398011 predicted 1077
2 SASI_Rn02_00398012 predicted 2095
3 SASI_Rn02_00398013 predicted 2072
4 SASI_Rn02_00398014 predicted 1661
5 SASI_Rn02_00398015 predicted 1071
6 SASI_Rn02_00398016 predicted 1524
7 SASI_Rn02_00398017 predicted 2286
8 SASI_Rn02_00398018 predicted 1925
9 SASI_Rn02_00398019 predicted 1007
10 SASI_Rn02_00398020 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313926 predicted 561
2 SASI_Mm01_00166371 predicted 2515
3 SASI_Mm01_00166372 predicted 1282
4 SASI_Mm01_00166373 predicted 2502
5 SASI_Mm01_00166374 predicted 1070
6 SASI_Mm01_00166375 predicted 2160
7 SASI_Mm01_00166376 predicted 1485
8 SASI_Mm01_00166377 predicted 2477
9 SASI_Mm01_00166378 predicted 1273
10 SASI_Mm02_00313927 predicted 1416
11 SASI_Mm01_00166379 predicted 1472
12 SASI_Mm01_00166380 predicted 535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004520
VALIDATED
KIF2A MISSION shRNA Bacterial Glycerol Stock
kinesin heavy chain member 2A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004520.3-709s21c1
Sequence:CCGGATGGTAGTGTTTCAGATATATCTCGAGATATATCTGAAACACTACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004520.3-1990s21c1
Sequence:CCGGCTGGTGATGTTCGTCCAATAACTCGAGTTATTGGACGAACATCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004520.3-963s21c1
Sequence:CCGGCCTATTGATGAACATAGGATACTCGAGTATCCTATGTTCATCAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004520.3-2502s21c1
Sequence:CCGGGCCATTTGAAAGTTTGGAATTCTCGAGAATTCCAAACTTTCAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004520.3-2331s21c1
Sequence:CCGGTTAACTGAACTGCGGGATAAACTCGAGTTTATCCCGCAGTTCAGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004520.1-994s1c1
Sequence:CCGGCCAAACTATAAGAAGCTAGAACTCGAGTTCTAGCTTCTTATAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004520.1-2128s1c1
Sequence:CCGGGCCATTTGAAAGTTTGGAATTCTCGAGAATTCCAAACTTTCAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004520.1-1616s1c1
Sequence:CCGGCTGGTGATGTTCGTCCAATAACTCGAGTTATTGGACGAACATCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004520.1-589s1c1
Sequence:CCGGCCTATTGATGAACATAGGATACTCGAGTATCCTATGTTCATCAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004520
VALIDATED
KIF2A MISSION shRNA shRNA Plasmid DNA
kinesin heavy chain member 2A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004520.3-709s21c1
Sequence:CCGGATGGTAGTGTTTCAGATATATCTCGAGATATATCTGAAACACTACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004520.3-1990s21c1
Sequence:CCGGCTGGTGATGTTCGTCCAATAACTCGAGTTATTGGACGAACATCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004520.3-963s21c1
Sequence:CCGGCCTATTGATGAACATAGGATACTCGAGTATCCTATGTTCATCAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004520.3-2502s21c1
Sequence:CCGGGCCATTTGAAAGTTTGGAATTCTCGAGAATTCCAAACTTTCAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004520.3-2331s21c1
Sequence:CCGGTTAACTGAACTGCGGGATAAACTCGAGTTTATCCCGCAGTTCAGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004520.1-994s1c1
Sequence:CCGGCCAAACTATAAGAAGCTAGAACTCGAGTTCTAGCTTCTTATAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004520.1-2128s1c1
Sequence:CCGGGCCATTTGAAAGTTTGGAATTCTCGAGAATTCCAAACTTTCAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004520.1-1616s1c1
Sequence:CCGGCTGGTGATGTTCGTCCAATAACTCGAGTTATTGGACGAACATCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004520.1-589s1c1
Sequence:CCGGCCTATTGATGAACATAGGATACTCGAGTATCCTATGTTCATCAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004520
VALIDATED
KIF2A MISSION shRNA Lentiviral Transduction Particles
kinesin heavy chain member 2A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004520.3-709s21c1
Sequence:CCGGATGGTAGTGTTTCAGATATATCTCGAGATATATCTGAAACACTACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004520.3-1990s21c1
Sequence:CCGGCTGGTGATGTTCGTCCAATAACTCGAGTTATTGGACGAACATCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004520.3-963s21c1
Sequence:CCGGCCTATTGATGAACATAGGATACTCGAGTATCCTATGTTCATCAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004520.3-2502s21c1
Sequence:CCGGGCCATTTGAAAGTTTGGAATTCTCGAGAATTCCAAACTTTCAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004520.3-2331s21c1
Sequence:CCGGTTAACTGAACTGCGGGATAAACTCGAGTTTATCCCGCAGTTCAGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004520.1-994s1c1
Sequence:CCGGCCAAACTATAAGAAGCTAGAACTCGAGTTCTAGCTTCTTATAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004520.1-2128s1c1
Sequence:CCGGGCCATTTGAAAGTTTGGAATTCTCGAGAATTCCAAACTTTCAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004520.1-1616s1c1
Sequence:CCGGCTGGTGATGTTCGTCCAATAACTCGAGTTATTGGACGAACATCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004520.1-589s1c1
Sequence:CCGGCCTATTGATGAACATAGGATACTCGAGTATCCTATGTTCATCAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008442
KIF2A MISSION shRNA Bacterial Glycerol Stock
kinesin heavy chain member 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008442.1-2713s1c1
Sequence:CCGGCGACTGTAAAGGCCACTTGAACTCGAGTTCAAGTGGCCTTTACAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-975s1c1
Sequence:CCGGCCAGGATGTTGATGCTACAAACTCGAGTTTGTAGCATCAACATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-1195s1c1
Sequence:CCGGCCCAAACAGAAAGTAGACTTACTCGAGTAAGTCTACTTTCTGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-1896s1c1
Sequence:CCGGCCGAGCCTTAGGTAGAAACAACTCGAGTTGTTTCTACCTAAGGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-974s1c1
Sequence:CCGGCCCAGGATGTTGATGCTACAACTCGAGTTGTAGCATCAACATCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008442
KIF2A MISSION shRNA shRNA Plasmid DNA
kinesin heavy chain member 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008442.1-2713s1c1
Sequence:CCGGCGACTGTAAAGGCCACTTGAACTCGAGTTCAAGTGGCCTTTACAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-975s1c1
Sequence:CCGGCCAGGATGTTGATGCTACAAACTCGAGTTTGTAGCATCAACATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-1195s1c1
Sequence:CCGGCCCAAACAGAAAGTAGACTTACTCGAGTAAGTCTACTTTCTGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-1896s1c1
Sequence:CCGGCCGAGCCTTAGGTAGAAACAACTCGAGTTGTTTCTACCTAAGGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-974s1c1
Sequence:CCGGCCCAGGATGTTGATGCTACAACTCGAGTTGTAGCATCAACATCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008442
KIF2A MISSION shRNA Lentiviral Transduction Particles
kinesin heavy chain member 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008442.1-2713s1c1
Sequence:CCGGCGACTGTAAAGGCCACTTGAACTCGAGTTCAAGTGGCCTTTACAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-975s1c1
Sequence:CCGGCCAGGATGTTGATGCTACAAACTCGAGTTTGTAGCATCAACATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-1195s1c1
Sequence:CCGGCCCAAACAGAAAGTAGACTTACTCGAGTAAGTCTACTTTCTGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-1896s1c1
Sequence:CCGGCCGAGCCTTAGGTAGAAACAACTCGAGTTGTTTCTACCTAAGGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008442.1-974s1c1
Sequence:CCGGCCCAGGATGTTGATGCTACAACTCGAGTTGTAGCATCAACATCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)