EMAIL THIS PAGE TO A FRIEND

KIF2B

kinesin family member 2B

87 Gene Product Result for
UniProtKB ID: Q8N4N8, Q96MA2, Q9BXG6
Gene ID:
Mouse(73470) kinesin family member 2B
Rat(287624) kinesin family member 2B
chicken(417390) kinesin family member 2B
cow(538921) kinesin family member 2B
dog(491092) kinesin family member 2B
domestic cat(101087183) kinesin family member 2B
domestic guinea pig(100725289) kinesin family member 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_126653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032559 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130411 MISSION® esiRNA esiRNA human KIF2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032559 Rosetta Predictions human pricing
XM_001074241 Rosetta Predictions rat pricing
XM_001081262 Rosetta Predictions rat pricing
NM_028547 Rosetta Predictions mouse pricing
XM_126653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360070 predicted 1198
2 SASI_Hs02_00360071 predicted 1569
3 SASI_Hs02_00360072 predicted 1595
4 SASI_Hs01_00174779 predicted 236
5 SASI_Hs01_00174780 predicted 222
6 SASI_Hs01_00174781 predicted 876
7 SASI_Hs01_00174782 predicted 1113
8 SASI_Hs02_00360073 predicted 1369
9 SASI_Hs02_00360074 predicted 1490
10 SASI_Hs02_00360075 predicted 1200
11 SASI_Hs01_00174776 predicted 1909
12 SASI_Hs01_00174777 predicted 1726
13 SASI_Hs01_00174778 predicted 1733
14 SASI_Hs01_00174783 predicted 1161
15 SASI_Hs01_00174784 predicted 1783
16 SASI_Hs01_00174785 predicted 1926
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345541 predicted 955
2 SASI_Rn02_00345542 predicted 346
3 SASI_Rn02_00345543 predicted 1756
4 SASI_Rn02_00345544 predicted 1108
5 SASI_Rn02_00345545 predicted 473
6 SASI_Rn02_00345546 predicted 828
7 SASI_Rn02_00345547 predicted 207
8 SASI_Rn02_00345548 predicted 666
9 SASI_Rn02_00345549 predicted 1727
10 SASI_Rn02_00345550 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371275 predicted 964
2 SASI_Rn02_00371276 predicted 341
3 SASI_Rn02_00371277 predicted 1757
4 SASI_Rn02_00371278 predicted 1108
5 SASI_Rn02_00371279 predicted 481
6 SASI_Rn02_00371280 predicted 835
7 SASI_Rn02_00371281 predicted 211
8 SASI_Rn02_00371282 predicted 669
9 SASI_Rn02_00371283 predicted 1732
10 SASI_Rn02_00371284 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334030 predicted 914
2 SASI_Mm02_00334031 predicted 1588
3 SASI_Mm02_00334032 predicted 1059
4 SASI_Mm02_00334033 predicted 1847
5 SASI_Mm02_00334034 predicted 321
6 SASI_Mm02_00334035 predicted 917
7 SASI_Mm02_00334036 predicted 1837
8 SASI_Mm02_00334037 predicted 1829
9 SASI_Mm02_00334038 predicted 633
10 SASI_Mm02_00334039 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228111 predicted 1843
2 SASI_Mm01_00228112 predicted 1671
3 SASI_Mm01_00228113 predicted 1862
4 SASI_Mm01_00228114 predicted 1446
5 SASI_Mm01_00228115 predicted 1481
6 SASI_Mm01_00228116 predicted 1783
7 SASI_Mm01_00228117 predicted 1796
8 SASI_Mm01_00228118 predicted 1549
9 SASI_Mm01_00228119 predicted 1851
10 SASI_Mm01_00228120 predicted 1727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126653
KIF2B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-1867s1c1
Sequence:CCGGCCTACTGTAGAGAAAGAGGAACTCGAGTTCCTCTTTCTCTACAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126653.4-2133s1c1
Sequence:CCGGAGAGATCAGGAGTGAGATCTTCTCGAGAAGATCTCACTCCTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-1077s1c1
Sequence:CCGGCCAAGATTGTTCTAAAGGCATCTCGAGATGCCTTTAGAACAATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-1723s1c1
Sequence:CCGGGCCAACAGAGTCAAAGAATTACTCGAGTAATTCTTTGACTCTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-529s1c1
Sequence:CCGGCCTTGTCTGATGAAGCGGAAACTCGAGTTTCCGCTTCATCAGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126653
KIF2B MISSION shRNA shRNA Plasmid DNA
kinesin family member 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-1867s1c1
Sequence:CCGGCCTACTGTAGAGAAAGAGGAACTCGAGTTCCTCTTTCTCTACAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126653.4-2133s1c1
Sequence:CCGGAGAGATCAGGAGTGAGATCTTCTCGAGAAGATCTCACTCCTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-1077s1c1
Sequence:CCGGCCAAGATTGTTCTAAAGGCATCTCGAGATGCCTTTAGAACAATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-1723s1c1
Sequence:CCGGGCCAACAGAGTCAAAGAATTACTCGAGTAATTCTTTGACTCTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-529s1c1
Sequence:CCGGCCTTGTCTGATGAAGCGGAAACTCGAGTTTCCGCTTCATCAGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126653
KIF2B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-1867s1c1
Sequence:CCGGCCTACTGTAGAGAAAGAGGAACTCGAGTTCCTCTTTCTCTACAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126653.4-2133s1c1
Sequence:CCGGAGAGATCAGGAGTGAGATCTTCTCGAGAAGATCTCACTCCTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-1077s1c1
Sequence:CCGGCCAAGATTGTTCTAAAGGCATCTCGAGATGCCTTTAGAACAATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-1723s1c1
Sequence:CCGGGCCAACAGAGTCAAAGAATTACTCGAGTAATTCTTTGACTCTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126653.4-529s1c1
Sequence:CCGGCCTTGTCTGATGAAGCGGAAACTCGAGTTTCCGCTTCATCAGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032559
KIF2B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 2B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032559.3-2164s1c1
Sequence:CCGGGCGAGAGATCAGGTCCGAAATCTCGAGATTTCGGACCTGATCTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-190s1c1
Sequence:CCGGGAAGCCACATTTCGGAGACATCTCGAGATGTCTCCGAAATGTGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-658s1c1
Sequence:CCGGCCTCGATGTCAATACCAGAAACTCGAGTTTCTGGTATTGACATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032559.4-1660s21c1
Sequence:CCGGGTGCTCCGGGACTCCTTTATACTCGAGTATAAAGGAGTCCCGGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-1465s1c1
Sequence:CCGGCCTCGTTGATTTAGCTGGGAACTCGAGTTCCCAGCTAAATCAACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-1959s1c1
Sequence:CCGGCCACAATTTCAGGGAAGGGATCTCGAGATCCCTTCCCTGAAATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032559.4-1880s21c1
Sequence:CCGGCCCTTCAGAGGGATGAATTTACTCGAGTAAATTCATCCCTCTGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032559.4-1452s21c1
Sequence:CCGGCCTGAAGTCAGGACGGATAATCTCGAGATTATCCGTCCTGACTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032559
KIF2B MISSION shRNA shRNA Plasmid DNA
kinesin family member 2B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032559.3-2164s1c1
Sequence:CCGGGCGAGAGATCAGGTCCGAAATCTCGAGATTTCGGACCTGATCTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-190s1c1
Sequence:CCGGGAAGCCACATTTCGGAGACATCTCGAGATGTCTCCGAAATGTGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-658s1c1
Sequence:CCGGCCTCGATGTCAATACCAGAAACTCGAGTTTCTGGTATTGACATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032559.4-1660s21c1
Sequence:CCGGGTGCTCCGGGACTCCTTTATACTCGAGTATAAAGGAGTCCCGGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-1465s1c1
Sequence:CCGGCCTCGTTGATTTAGCTGGGAACTCGAGTTCCCAGCTAAATCAACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-1959s1c1
Sequence:CCGGCCACAATTTCAGGGAAGGGATCTCGAGATCCCTTCCCTGAAATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032559.4-1880s21c1
Sequence:CCGGCCCTTCAGAGGGATGAATTTACTCGAGTAAATTCATCCCTCTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032559.4-1452s21c1
Sequence:CCGGCCTGAAGTCAGGACGGATAATCTCGAGATTATCCGTCCTGACTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032559
KIF2B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 2B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032559.3-2164s1c1
Sequence:CCGGGCGAGAGATCAGGTCCGAAATCTCGAGATTTCGGACCTGATCTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-190s1c1
Sequence:CCGGGAAGCCACATTTCGGAGACATCTCGAGATGTCTCCGAAATGTGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-658s1c1
Sequence:CCGGCCTCGATGTCAATACCAGAAACTCGAGTTTCTGGTATTGACATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032559.4-1660s21c1
Sequence:CCGGGTGCTCCGGGACTCCTTTATACTCGAGTATAAAGGAGTCCCGGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-1465s1c1
Sequence:CCGGCCTCGTTGATTTAGCTGGGAACTCGAGTTCCCAGCTAAATCAACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032559.3-1959s1c1
Sequence:CCGGCCACAATTTCAGGGAAGGGATCTCGAGATCCCTTCCCTGAAATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032559.4-1880s21c1
Sequence:CCGGCCCTTCAGAGGGATGAATTTACTCGAGTAAATTCATCCCTCTGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032559.4-1452s21c1
Sequence:CCGGCCTGAAGTCAGGACGGATAATCTCGAGATTATCCGTCCTGACTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)