EMAIL THIS PAGE TO A FRIEND

KIF2C

kinesin family member 2C

82 Gene Product Result for
Synonyms: KNSL6 MCAK
Gene ID:
Human(11004) Summary: The protein encoded by this gene is a member of kinesin-like protein family. Proteins of this family are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein is important for anaphase chromosome segregation and may be required to coordinate the onset of sister centromere separation. [provided by RefSeq, Jul 2008]
Mouse(73804) kinesin family member 2C
Rat(171529) kinesin family member 2C
sheep(101117203) kinesin family member 2C
Domestic Rabbit(100349671) kinesin family member 2C
domestic guinea pig(100721934) kinesin family member 2C
naked mole-rat(101700436) kinesin family member 2C
Zebrafish(100136875) kinesin family member 2C
cow(533161) kinesin family member 2C
Horse(100052754) kinesin family member 2C
domestic cat(101087504) kinesin family member 2C
dog(475382) kinesin family member 2C
chicken(424583) kinesin family member 2C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006845 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006845 Rosetta Predictions human pricing
NM_001085369 Rosetta Predictions rat pricing
NM_134472 Rosetta Predictions rat pricing
XM_579644 Rosetta Predictions rat pricing
NM_134471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111628 predicted 292
2 SASI_Hs01_00111629 predicted 1813
3 SASI_Hs02_00342437 predicted 878
4 SASI_Hs01_00111630 predicted 1026
5 SASI_Hs01_00111631 predicted 795
6 SASI_Hs01_00111632 predicted 1533
7 SASI_Hs01_00111633 predicted 2127
8 SASI_Hs01_00111634 predicted 864
9 SASI_Hs01_00111635 predicted 1177
10 SASI_Hs01_00111636 predicted 1953
11 SASI_Hs01_00111637 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208979 predicted 550
2 SASI_Rn02_00208980 predicted 539
3 SASI_Rn02_00208981 predicted 1489
4 SASI_Rn02_00208982 predicted 883
5 SASI_Rn02_00208983 predicted 759
6 SASI_Rn02_00208984 predicted 1440
7 SASI_Rn02_00208985 predicted 2126
8 SASI_Rn02_00208986 predicted 1032
9 SASI_Rn02_00208987 predicted 2109
10 SASI_Rn02_00208988 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268082 predicted 429
2 SASI_Rn02_00268083 predicted 425
3 SASI_Rn02_00268084 predicted 1376
4 SASI_Rn02_00268085 predicted 776
5 SASI_Rn02_00268086 predicted 646
6 SASI_Rn02_00268087 predicted 1331
7 SASI_Rn02_00268088 predicted 2015
8 SASI_Rn02_00268089 predicted 919
9 SASI_Rn02_00268090 predicted 1994
10 SASI_Rn02_00268091 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183306 predicted 443
2 SASI_Rn01_00183307 predicted 436
3 SASI_Rn01_00183308 predicted 1382
4 SASI_Rn01_00183309 predicted 777
5 SASI_Rn01_00183310 predicted 646
6 SASI_Rn01_00183311 predicted 594
7 SASI_Rn01_00183312 predicted 1337
8 SASI_Rn01_00183313 predicted 929
9 SASI_Rn01_00183314 predicted 920
10 SASI_Rn01_00183315 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165101 predicted 749
2 SASI_Mm01_00165102 predicted 1475
3 SASI_Mm01_00165103 predicted 976
4 SASI_Mm02_00339580 predicted 1881
5 SASI_Mm01_00165104 predicted 878
6 SASI_Mm02_00339581 predicted 1758
7 SASI_Mm02_00339582 predicted 1744
8 SASI_Mm02_00339583 predicted 846
9 SASI_Mm01_00165109 predicted 762
10 SASI_Mm01_00165110 predicted 818
11 SASI_Mm01_00165105 predicted 346
12 SASI_Mm01_00165106 predicted 987
13 SASI_Mm01_00165107 predicted 1782
14 SASI_Mm01_00165108 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134471
VALIDATED
KIF2C MISSION shRNA Bacterial Glycerol Stock
kinesin family member 2C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-1830s21c1
Sequence:CCGGGCTCCTGTGAATACACCTTAACTCGAGTTAAGGTGTATTCACAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-219s21c1
Sequence:CCGGGCACAGTGAACGTGGAGAAATCTCGAGATTTCTCCACGTTCACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-818s21c1
Sequence:CCGGGCCCGGATGATCAAAGAATTTCTCGAGAAATTCTTTGATCATCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-1303s21c1
Sequence:CCGGCCTGGAAGTTTATGTGACATTCTCGAGAATGTCACATAAACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134471.4-2373s21c1
Sequence:CCGGGCTTTGGTTAGGAACTGAGTTCTCGAGAACTCAGTTCCTAACCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-2314s1c1
Sequence:CCGGGCTTTGGTTAGGAACTGAGTTCTCGAGAACTCAGTTCCTAACCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-1771s1c1
Sequence:CCGGGCTCCTGTGAATACACCTTAACTCGAGTTAAGGTGTATTCACAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-160s1c1
Sequence:CCGGGCACAGTGAACGTGGAGAAATCTCGAGATTTCTCCACGTTCACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-759s1c1
Sequence:CCGGGCCCGGATGATCAAAGAATTTCTCGAGAAATTCTTTGATCATCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-1244s1c1
Sequence:CCGGCCTGGAAGTTTATGTGACATTCTCGAGAATGTCACATAAACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134471
VALIDATED
KIF2C MISSION shRNA shRNA Plasmid DNA
kinesin family member 2C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-1830s21c1
Sequence:CCGGGCTCCTGTGAATACACCTTAACTCGAGTTAAGGTGTATTCACAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-219s21c1
Sequence:CCGGGCACAGTGAACGTGGAGAAATCTCGAGATTTCTCCACGTTCACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-818s21c1
Sequence:CCGGGCCCGGATGATCAAAGAATTTCTCGAGAAATTCTTTGATCATCCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-1303s21c1
Sequence:CCGGCCTGGAAGTTTATGTGACATTCTCGAGAATGTCACATAAACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134471.4-2373s21c1
Sequence:CCGGGCTTTGGTTAGGAACTGAGTTCTCGAGAACTCAGTTCCTAACCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-2314s1c1
Sequence:CCGGGCTTTGGTTAGGAACTGAGTTCTCGAGAACTCAGTTCCTAACCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-1771s1c1
Sequence:CCGGGCTCCTGTGAATACACCTTAACTCGAGTTAAGGTGTATTCACAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-160s1c1
Sequence:CCGGGCACAGTGAACGTGGAGAAATCTCGAGATTTCTCCACGTTCACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-759s1c1
Sequence:CCGGGCCCGGATGATCAAAGAATTTCTCGAGAAATTCTTTGATCATCCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-1244s1c1
Sequence:CCGGCCTGGAAGTTTATGTGACATTCTCGAGAATGTCACATAAACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134471
VALIDATED
KIF2C MISSION shRNA Lentiviral Transduction Particles
kinesin family member 2C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-1830s21c1
Sequence:CCGGGCTCCTGTGAATACACCTTAACTCGAGTTAAGGTGTATTCACAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-219s21c1
Sequence:CCGGGCACAGTGAACGTGGAGAAATCTCGAGATTTCTCCACGTTCACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-818s21c1
Sequence:CCGGGCCCGGATGATCAAAGAATTTCTCGAGAAATTCTTTGATCATCCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134471.4-1303s21c1
Sequence:CCGGCCTGGAAGTTTATGTGACATTCTCGAGAATGTCACATAAACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134471.4-2373s21c1
Sequence:CCGGGCTTTGGTTAGGAACTGAGTTCTCGAGAACTCAGTTCCTAACCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-2314s1c1
Sequence:CCGGGCTTTGGTTAGGAACTGAGTTCTCGAGAACTCAGTTCCTAACCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-1771s1c1
Sequence:CCGGGCTCCTGTGAATACACCTTAACTCGAGTTAAGGTGTATTCACAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-160s1c1
Sequence:CCGGGCACAGTGAACGTGGAGAAATCTCGAGATTTCTCCACGTTCACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-759s1c1
Sequence:CCGGGCCCGGATGATCAAAGAATTTCTCGAGAAATTCTTTGATCATCCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134471.2-1244s1c1
Sequence:CCGGCCTGGAAGTTTATGTGACATTCTCGAGAATGTCACATAAACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006845
VALIDATED
KIF2C MISSION shRNA Bacterial Glycerol Stock
kinesin family member 2C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-911s21c1
Sequence:CCGGCGCCCACTGAATAAGCAAGAACTCGAGTTCTTGCTTATTCAGTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-812s21c1
Sequence:CCGGGCCCGAATGATTAAAGAATTTCTCGAGAAATTCTTTAATCATTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-2717s21c1
Sequence:CCGGGCACTGAATGTCTTGTACTTTCTCGAGAAAGTACAAGACATTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-995s21c1
Sequence:CCGGCCCAAGTTGAAAGTGGACTTACTCGAGTAAGTCCACTTTCAACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-2656s1c1
Sequence:CCGGGCACTGAATGTCTTGTACTTTCTCGAGAAAGTACAAGACATTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-751s1c1
Sequence:CCGGGCCCGAATGATTAAAGAATTTCTCGAGAAATTCTTTAATCATTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-934s1c1
Sequence:CCGGCCCAAGTTGAAAGTGGACTTACTCGAGTAAGTCCACTTTCAACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-850s1c1
Sequence:CCGGCGCCCACTGAATAAGCAAGAACTCGAGTTCTTGCTTATTCAGTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-851s1c1
Sequence:CCGGGCCCACTGAATAAGCAAGAATCTCGAGATTCTTGCTTATTCAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006845
VALIDATED
KIF2C MISSION shRNA shRNA Plasmid DNA
kinesin family member 2C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-911s21c1
Sequence:CCGGCGCCCACTGAATAAGCAAGAACTCGAGTTCTTGCTTATTCAGTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-812s21c1
Sequence:CCGGGCCCGAATGATTAAAGAATTTCTCGAGAAATTCTTTAATCATTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-2717s21c1
Sequence:CCGGGCACTGAATGTCTTGTACTTTCTCGAGAAAGTACAAGACATTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-995s21c1
Sequence:CCGGCCCAAGTTGAAAGTGGACTTACTCGAGTAAGTCCACTTTCAACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-2656s1c1
Sequence:CCGGGCACTGAATGTCTTGTACTTTCTCGAGAAAGTACAAGACATTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-751s1c1
Sequence:CCGGGCCCGAATGATTAAAGAATTTCTCGAGAAATTCTTTAATCATTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-934s1c1
Sequence:CCGGCCCAAGTTGAAAGTGGACTTACTCGAGTAAGTCCACTTTCAACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-850s1c1
Sequence:CCGGCGCCCACTGAATAAGCAAGAACTCGAGTTCTTGCTTATTCAGTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-851s1c1
Sequence:CCGGGCCCACTGAATAAGCAAGAATCTCGAGATTCTTGCTTATTCAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006845
VALIDATED
KIF2C MISSION shRNA Lentiviral Transduction Particles
kinesin family member 2C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-911s21c1
Sequence:CCGGCGCCCACTGAATAAGCAAGAACTCGAGTTCTTGCTTATTCAGTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-812s21c1
Sequence:CCGGGCCCGAATGATTAAAGAATTTCTCGAGAAATTCTTTAATCATTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-2717s21c1
Sequence:CCGGGCACTGAATGTCTTGTACTTTCTCGAGAAAGTACAAGACATTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006845.3-995s21c1
Sequence:CCGGCCCAAGTTGAAAGTGGACTTACTCGAGTAAGTCCACTTTCAACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-2656s1c1
Sequence:CCGGGCACTGAATGTCTTGTACTTTCTCGAGAAAGTACAAGACATTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-751s1c1
Sequence:CCGGGCCCGAATGATTAAAGAATTTCTCGAGAAATTCTTTAATCATTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-934s1c1
Sequence:CCGGCCCAAGTTGAAAGTGGACTTACTCGAGTAAGTCCACTTTCAACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-850s1c1
Sequence:CCGGCGCCCACTGAATAAGCAAGAACTCGAGTTCTTGCTTATTCAGTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006845.2-851s1c1
Sequence:CCGGGCCCACTGAATAAGCAAGAATCTCGAGATTCTTGCTTATTCAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)