EMAIL THIS PAGE TO A FRIEND

KIF3A

kinesin family member 3A

228 Gene Product Result for
Synonyms: FLA10 KLP-20
UniProtKB ID: Q9Y496, A8MSW9, Q59EN1, Q86XE9, Q9Y6V4
Gene ID:
Mouse(16568) kinesin family member 3A
Rat(84392) kinesin family member 3a
Zebrafish(550267) kinesin family member 3A
cow(541246) kinesin family member 3A
Horse(100072851) kinesin family member 3A
domestic cat(101096284) kinesin family member 3A
dog(474675) kinesin family member 3A
chicken(416332) kinesin family member 3A
domestic guinea pig(100733941) kinesin family member 3A
naked mole-rat(101717121) kinesin family member 3A
sheep(101122522) kinesin family member 3A
Domestic Rabbit(100008869) kinesin family member 3A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412685 ANTI-KIF3A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human,
western blot pricing
K3513 Anti-KIF3A antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
immunohistochemistry, microarray, western blot pricing
AV33917 Anti-KIF3A antibody produced in rabbit affinity isolated antibody canine, human, rabbit, bovine, rabbit, horse, mouse, rat, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007054 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007054 Rosetta Predictions human pricing
XM_001073130 Rosetta Predictions rat pricing
XM_001073152 Rosetta Predictions rat pricing
XM_001073184 Rosetta Predictions rat pricing
XM_001073223 Rosetta Predictions rat pricing
XM_001073255 Rosetta Predictions rat pricing
XM_001073256 Rosetta Predictions rat pricing
XM_001073282 Rosetta Predictions rat pricing
XM_001073283 Rosetta Predictions rat pricing
XM_001073311 Rosetta Predictions rat pricing
XM_001073312 Rosetta Predictions rat pricing
XM_001073348 Rosetta Predictions rat pricing
XM_001073375 Rosetta Predictions rat pricing
XM_001073405 Rosetta Predictions rat pricing
NM_008443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208830 predicted 944
2 SASI_Hs01_00208831 predicted 2326
3 SASI_Hs01_00208832 predicted 313
4 SASI_Hs01_00208833 predicted 2240
5 SASI_Hs02_00342858 predicted 1801
6 SASI_Hs01_00208835 predicted 978
7 SASI_Hs01_00208836 predicted 1927
8 SASI_Hs01_00208837 predicted 444
9 SASI_Hs02_00342859 predicted 669
10 SASI_Hs01_00208839 predicted 734
11 SASI_Hs01_00208834 predicted 2202
12 SASI_Hs01_00208838 predicted 1881
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341619 predicted 1629
2 SASI_Rn02_00341620 predicted 202
3 SASI_Rn02_00341621 predicted 916
4 SASI_Rn02_00341622 predicted 567
5 SASI_Rn02_00341623 predicted 281
6 SASI_Rn02_00341624 predicted 1844
7 SASI_Rn02_00341625 predicted 680
8 SASI_Rn02_00341626 predicted 341
9 SASI_Rn02_00341627 predicted 294
10 SASI_Rn02_00341628 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341670 predicted 260
2 SASI_Rn02_00341671 predicted 1140
3 SASI_Rn02_00341672 predicted 620
4 SASI_Rn02_00341673 predicted 342
5 SASI_Rn02_00341674 predicted 1946
6 SASI_Rn02_00341675 predicted 732
7 SASI_Rn02_00341676 predicted 352
8 SASI_Rn02_00341677 predicted 1127
9 SASI_Rn02_00341678 predicted 401
10 SASI_Rn02_00341679 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341834 predicted 203
2 SASI_Rn02_00341835 predicted 915
3 SASI_Rn02_00341836 predicted 1077
4 SASI_Rn02_00341837 predicted 569
5 SASI_Rn02_00341838 predicted 288
6 SASI_Rn02_00341839 predicted 1847
7 SASI_Rn02_00341840 predicted 676
8 SASI_Rn02_00341841 predicted 296
9 SASI_Rn02_00341842 predicted 1074
10 SASI_Rn02_00341843 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341956 predicted 1253
2 SASI_Rn02_00341957 predicted 202
3 SASI_Rn02_00341958 predicted 1084
4 SASI_Rn02_00341959 predicted 569
5 SASI_Rn02_00341960 predicted 279
6 SASI_Rn02_00341961 predicted 1881
7 SASI_Rn02_00341962 predicted 677
8 SASI_Rn02_00341963 predicted 295
9 SASI_Rn02_00341964 predicted 1065
10 SASI_Rn02_00341965 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342082 predicted 1627
2 SASI_Rn02_00342083 predicted 204
3 SASI_Rn02_00342084 predicted 922
4 SASI_Rn02_00342085 predicted 568
5 SASI_Rn02_00342086 predicted 280
6 SASI_Rn02_00342087 predicted 1850
7 SASI_Rn02_00342088 predicted 675
8 SASI_Rn02_00342089 predicted 338
9 SASI_Rn02_00342090 predicted 301
10 SASI_Rn02_00342091 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342092 predicted 218
2 SASI_Rn02_00342093 predicted 938
3 SASI_Rn02_00342094 predicted 1095
4 SASI_Rn02_00342095 predicted 587
5 SASI_Rn02_00342096 predicted 305
6 SASI_Rn02_00342097 predicted 1884
7 SASI_Rn02_00342098 predicted 695
8 SASI_Rn02_00342099 predicted 321
9 SASI_Rn02_00342100 predicted 1087
10 SASI_Rn02_00342101 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342195 predicted 253
2 SASI_Rn02_00342196 predicted 1139
3 SASI_Rn02_00342197 predicted 620
4 SASI_Rn02_00342198 predicted 334
5 SASI_Rn02_00342199 predicted 1946
6 SASI_Rn02_00342200 predicted 730
7 SASI_Rn02_00342201 predicted 351
8 SASI_Rn02_00342202 predicted 1124
9 SASI_Rn02_00342203 predicted 405
10 SASI_Rn02_00342204 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342205 predicted 204
2 SASI_Rn02_00342206 predicted 919
3 SASI_Rn02_00342207 predicted 1083
4 SASI_Rn02_00342208 predicted 566
5 SASI_Rn02_00342209 predicted 287
6 SASI_Rn02_00342210 predicted 1882
7 SASI_Rn02_00342211 predicted 675
8 SASI_Rn02_00342212 predicted 340
9 SASI_Rn02_00342213 predicted 295
10 SASI_Rn02_00342214 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342322 predicted 203
2 SASI_Rn02_00342323 predicted 919
3 SASI_Rn02_00342324 predicted 1082
4 SASI_Rn02_00342325 predicted 562
5 SASI_Rn02_00342326 predicted 288
6 SASI_Rn02_00342327 predicted 1845
7 SASI_Rn02_00342328 predicted 672
8 SASI_Rn02_00342329 predicted 296
9 SASI_Rn02_00342330 predicted 1067
10 SASI_Rn02_00342331 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342332 predicted 203
2 SASI_Rn02_00342333 predicted 920
3 SASI_Rn02_00342334 predicted 1083
4 SASI_Rn02_00342335 predicted 566
5 SASI_Rn02_00342336 predicted 292
6 SASI_Rn02_00342337 predicted 1895
7 SASI_Rn02_00342338 predicted 681
8 SASI_Rn02_00342339 predicted 302
9 SASI_Rn02_00342340 predicted 1073
10 SASI_Rn02_00342341 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342465 predicted 221
2 SASI_Rn02_00342466 predicted 940
3 SASI_Rn02_00342467 predicted 1104
4 SASI_Rn02_00342468 predicted 581
5 SASI_Rn02_00342469 predicted 304
6 SASI_Rn02_00342470 predicted 1882
7 SASI_Rn02_00342471 predicted 699
8 SASI_Rn02_00342472 predicted 314
9 SASI_Rn02_00342473 predicted 1093
10 SASI_Rn02_00342474 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342565 predicted 205
2 SASI_Rn02_00342566 predicted 923
3 SASI_Rn02_00342567 predicted 1076
4 SASI_Rn02_00342568 predicted 560
5 SASI_Rn02_00342569 predicted 285
6 SASI_Rn02_00342570 predicted 1875
7 SASI_Rn02_00342571 predicted 677
8 SASI_Rn02_00342572 predicted 336
9 SASI_Rn02_00342573 predicted 303
10 SASI_Rn02_00342574 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342711 predicted 206
2 SASI_Rn02_00342712 predicted 923
3 SASI_Rn02_00342713 predicted 1087
4 SASI_Rn02_00342714 predicted 565
5 SASI_Rn02_00342715 predicted 287
6 SASI_Rn02_00342716 predicted 1889
7 SASI_Rn02_00342717 predicted 678
8 SASI_Rn02_00342718 predicted 302
9 SASI_Rn02_00342719 predicted 1075
10 SASI_Rn02_00342720 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024254 predicted 271
2 SASI_Mm01_00024255 predicted 2332
3 SASI_Mm01_00024256 predicted 364
4 SASI_Mm01_00024257 predicted 1098
5 SASI_Mm01_00024258 predicted 2220
6 SASI_Mm01_00024259 predicted 319
7 SASI_Mm01_00024260 predicted 390
8 SASI_Mm01_00024261 predicted 1068
9 SASI_Mm01_00024262 predicted 1088
10 SASI_Mm01_00024263 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008443
KIF3A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 3A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008443.2-2959s1c1
Sequence:CCGGCCCTGGACATACAGCTTACAACTCGAGTTGTAAGCTGTATGTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-786s1c1
Sequence:CCGGCGCCATCTTTACAATTACTATCTCGAGATAGTAATTGTAAAGATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-2175s1c1
Sequence:CCGGGCGAAGAAAGCGTTCTGCAAACTCGAGTTTGCAGAACGCTTTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-295s1c1
Sequence:CCGGCCAAAGACATTTACTTTCGATCTCGAGATCGAAAGTAAATGTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-1202s1c1
Sequence:CCGGTCCGCCAGTTTCAGAAAGAAACTCGAGTTTCTTTCTGAAACTGGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008443.3-2507s21c1
Sequence:CCGGTTCCGTTGTTGTACGTGAATGCTCGAGCATTCACGTACAACAACGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-1109s21c1
Sequence:CCGGATATTGGGCCAGCAGATTATACTCGAGTATAATCTGCTGGCCCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-382s21c1
Sequence:CCGGTTAACTGCAAGACCAATTATTCTCGAGAATAATTGGTCTTGCAGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-980s21c1
Sequence:CCGGCTACCCTGGGCAACGTTATTTCTCGAGAAATAACGTTGCCCAGGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-668s21c1
Sequence:CCGGGGCCTGATGTGGGAGTATATACTCGAGTATATACTCCCACATCAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008443
KIF3A MISSION shRNA shRNA Plasmid DNA
kinesin family member 3A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008443.2-2959s1c1
Sequence:CCGGCCCTGGACATACAGCTTACAACTCGAGTTGTAAGCTGTATGTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-786s1c1
Sequence:CCGGCGCCATCTTTACAATTACTATCTCGAGATAGTAATTGTAAAGATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-2175s1c1
Sequence:CCGGGCGAAGAAAGCGTTCTGCAAACTCGAGTTTGCAGAACGCTTTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-295s1c1
Sequence:CCGGCCAAAGACATTTACTTTCGATCTCGAGATCGAAAGTAAATGTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-1202s1c1
Sequence:CCGGTCCGCCAGTTTCAGAAAGAAACTCGAGTTTCTTTCTGAAACTGGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008443.3-2507s21c1
Sequence:CCGGTTCCGTTGTTGTACGTGAATGCTCGAGCATTCACGTACAACAACGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-1109s21c1
Sequence:CCGGATATTGGGCCAGCAGATTATACTCGAGTATAATCTGCTGGCCCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-382s21c1
Sequence:CCGGTTAACTGCAAGACCAATTATTCTCGAGAATAATTGGTCTTGCAGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-980s21c1
Sequence:CCGGCTACCCTGGGCAACGTTATTTCTCGAGAAATAACGTTGCCCAGGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-668s21c1
Sequence:CCGGGGCCTGATGTGGGAGTATATACTCGAGTATATACTCCCACATCAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008443
KIF3A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 3A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008443.2-2959s1c1
Sequence:CCGGCCCTGGACATACAGCTTACAACTCGAGTTGTAAGCTGTATGTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-786s1c1
Sequence:CCGGCGCCATCTTTACAATTACTATCTCGAGATAGTAATTGTAAAGATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-2175s1c1
Sequence:CCGGGCGAAGAAAGCGTTCTGCAAACTCGAGTTTGCAGAACGCTTTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-295s1c1
Sequence:CCGGCCAAAGACATTTACTTTCGATCTCGAGATCGAAAGTAAATGTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008443.2-1202s1c1
Sequence:CCGGTCCGCCAGTTTCAGAAAGAAACTCGAGTTTCTTTCTGAAACTGGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008443.3-2507s21c1
Sequence:CCGGTTCCGTTGTTGTACGTGAATGCTCGAGCATTCACGTACAACAACGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-1109s21c1
Sequence:CCGGATATTGGGCCAGCAGATTATACTCGAGTATAATCTGCTGGCCCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-382s21c1
Sequence:CCGGTTAACTGCAAGACCAATTATTCTCGAGAATAATTGGTCTTGCAGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-980s21c1
Sequence:CCGGCTACCCTGGGCAACGTTATTTCTCGAGAAATAACGTTGCCCAGGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008443.3-668s21c1
Sequence:CCGGGGCCTGATGTGGGAGTATATACTCGAGTATATACTCCCACATCAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007054
VALIDATED
KIF3A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 3A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007054.4-2737s1c1
Sequence:CCGGGCCTGTTTGAACACATTCTAACTCGAGTTAGAATGTGTTCAAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007054.4-1945s1c1
Sequence:CCGGCGGGATTATCAGGAAATGATTCTCGAGAATCATTTCCTGATAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007054.4-781s1c1
Sequence:CCGGGCAACTAATATGAACGAACATCTCGAGATGTTCGTTCATATTAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007054.4-2134s1c1
Sequence:CCGGCGTCAGTCTTTGATGAAACTACTCGAGTAGTTTCATCAAAGACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007054.5-1908s21c1
Sequence:CCGGTTCGACTTCAGATGCTTATTACTCGAGTAATAAGCATCTGAAGTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007054.5-1719s21c1
Sequence:CCGGAGCAAGAACGCTTGGATATTGCTCGAGCAATATCCAAGCGTTCTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007054.5-651s21c1
Sequence:CCGGCACAAAGGTTAGAGGTTAAAGCTCGAGCTTTAACCTCTAACCTTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007054
VALIDATED
KIF3A MISSION shRNA shRNA Plasmid DNA
kinesin family member 3A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007054.4-2737s1c1
Sequence:CCGGGCCTGTTTGAACACATTCTAACTCGAGTTAGAATGTGTTCAAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007054.4-1945s1c1
Sequence:CCGGCGGGATTATCAGGAAATGATTCTCGAGAATCATTTCCTGATAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007054.4-781s1c1
Sequence:CCGGGCAACTAATATGAACGAACATCTCGAGATGTTCGTTCATATTAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007054.4-2134s1c1
Sequence:CCGGCGTCAGTCTTTGATGAAACTACTCGAGTAGTTTCATCAAAGACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007054.5-1908s21c1
Sequence:CCGGTTCGACTTCAGATGCTTATTACTCGAGTAATAAGCATCTGAAGTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007054.5-1719s21c1
Sequence:CCGGAGCAAGAACGCTTGGATATTGCTCGAGCAATATCCAAGCGTTCTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007054.5-651s21c1
Sequence:CCGGCACAAAGGTTAGAGGTTAAAGCTCGAGCTTTAACCTCTAACCTTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007054
VALIDATED
KIF3A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 3A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007054.4-2737s1c1
Sequence:CCGGGCCTGTTTGAACACATTCTAACTCGAGTTAGAATGTGTTCAAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007054.4-1945s1c1
Sequence:CCGGCGGGATTATCAGGAAATGATTCTCGAGAATCATTTCCTGATAATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007054.4-781s1c1
Sequence:CCGGGCAACTAATATGAACGAACATCTCGAGATGTTCGTTCATATTAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007054.4-2134s1c1
Sequence:CCGGCGTCAGTCTTTGATGAAACTACTCGAGTAGTTTCATCAAAGACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007054.5-1908s21c1
Sequence:CCGGTTCGACTTCAGATGCTTATTACTCGAGTAATAAGCATCTGAAGTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007054.5-1719s21c1
Sequence:CCGGAGCAAGAACGCTTGGATATTGCTCGAGCAATATCCAAGCGTTCTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007054.5-651s21c1
Sequence:CCGGCACAAAGGTTAGAGGTTAAAGCTCGAGCTTTAACCTCTAACCTTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)