EMAIL THIS PAGE TO A FRIEND

KIF3B

kinesin family member 3B

266 Gene Product Result for
Synonyms: FLA8 HH0048 KLP-11
UniProtKB ID: O15066, B2RMP4, E1P5M5
Gene ID:
Human(9371) Summary: The protein encoded by this gene acts as a heterodimer with kinesin family member 3A to aid in chromosome movement during mitosis and meiosis. The encoded protein is a plus end-directed microtubule motor and can interact with the SMC3 subunit of the cohesin complex. In addition, the encoded protein may be involved in the intracellular movement of membranous organelles. This protein and kinesin family member 3A form the kinesin II subfamily of the kinesin superfamily. [provided by RefSeq, Jul 2008]
Mouse(16569) kinesin family member 3B
Rat(296284) kinesin family member 3B
sheep(101104261) kinesin family member 3B
Domestic Rabbit(100342187) kinesin family member 3B
domestic guinea pig(100723022) kinesin family member 3B
naked mole-rat(101707062) kinesin family member 3B
Zebrafish(100101641) kinesin family member 3B
chicken(419284) kinesin family member 3B
cow(508404) kinesin family member 3B
Horse(100053850) kinesin family member 3B
domestic cat(101094089) kinesin family member 3B
dog(485830) kinesin family member 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004798 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004798 Rosetta Predictions human pricing
NM_001106529 Rosetta Predictions rat pricing
NM_008444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019442 predicted 2073
2 SASI_Hs01_00019443 predicted 2365
3 SASI_Hs01_00019445 predicted 2449
4 SASI_Hs01_00019446 predicted 1119
5 SASI_Hs01_00019447 predicted 337
6 SASI_Hs01_00019448 predicted 2010
7 SASI_Hs01_00019449 predicted 2263
8 SASI_Hs01_00019450 predicted 518
9 SASI_Hs01_00019451 predicted 2273
10 SASI_Hs02_00338330 predicted 2434
11 SASI_Hs01_00019444 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219858 predicted 1002
2 SASI_Rn02_00219859 predicted 562
3 SASI_Rn02_00219860 predicted 689
4 SASI_Rn02_00219861 predicted 2253
5 SASI_Rn02_00219862 predicted 217
6 SASI_Rn02_00219863 predicted 790
7 SASI_Rn02_00219864 predicted 2430
8 SASI_Rn02_00219865 predicted 1814
9 SASI_Rn02_00219866 predicted 2281
10 SASI_Rn02_00219867 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079563 predicted 590
2 SASI_Mm01_00079564 predicted 556
3 SASI_Mm01_00079565 predicted 695
4 SASI_Mm01_00079566 predicted 995
5 SASI_Mm01_00079567 predicted 648
6 SASI_Mm01_00079568 predicted 996
7 SASI_Mm02_00313928 predicted 2431
8 SASI_Mm01_00079570 predicted 335
9 SASI_Mm01_00079571 predicted 2412
10 SASI_Mm02_00313929 predicted 210
11 SASI_Mm01_00079562 predicted 647
12 SASI_Mm01_00079569 predicted 2428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008444
KIF3B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 3B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008444.4-2609s21c1
Sequence:CCGGAGAATGCATGGGTAAGGTAAACTCGAGTTTACCTTACCCATGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-802s21c1
Sequence:CCGGGCAATCTTTGTTATCACTATTCTCGAGAATAGTGATAACAAAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-1892s21c1
Sequence:CCGGTAAAGCTCAAGCATCTTATTACTCGAGTAATAAGATGCTTGAGCTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-410s21c1
Sequence:CCGGAGGGTTTCAATGGCACAATTTCTCGAGAAATTGTGCCATTGAAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-850s1c1
Sequence:CCGGCGGGTAGGAAAGCTGAATCTTCTCGAGAAGATTCAGCTTTCCTACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-1971s1c1
Sequence:CCGGCCATTGGAAATTACATCCTATCTCGAGATAGGATGTAATTTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008444.2-2732s1c1
Sequence:CCGGCCTCCCTTCTTGTTAAACAATCTCGAGATTGTTTAACAAGAAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-750s1c1
Sequence:CCGGCGGTGCTACAAACATGAATGACTCGAGTCATTCATGTTTGTAGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-396s1c1
Sequence:CCGGGCAGGGTTTCAATGGCACAATCTCGAGATTGTGCCATTGAAACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-1984s21c1
Sequence:CCGGCATTGGAAATTACATCCTATACTCGAGTATAGGATGTAATTTCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008444
KIF3B MISSION shRNA shRNA Plasmid DNA
kinesin family member 3B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008444.4-2609s21c1
Sequence:CCGGAGAATGCATGGGTAAGGTAAACTCGAGTTTACCTTACCCATGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-802s21c1
Sequence:CCGGGCAATCTTTGTTATCACTATTCTCGAGAATAGTGATAACAAAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-1892s21c1
Sequence:CCGGTAAAGCTCAAGCATCTTATTACTCGAGTAATAAGATGCTTGAGCTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-410s21c1
Sequence:CCGGAGGGTTTCAATGGCACAATTTCTCGAGAAATTGTGCCATTGAAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-850s1c1
Sequence:CCGGCGGGTAGGAAAGCTGAATCTTCTCGAGAAGATTCAGCTTTCCTACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-1971s1c1
Sequence:CCGGCCATTGGAAATTACATCCTATCTCGAGATAGGATGTAATTTCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008444.2-2732s1c1
Sequence:CCGGCCTCCCTTCTTGTTAAACAATCTCGAGATTGTTTAACAAGAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-750s1c1
Sequence:CCGGCGGTGCTACAAACATGAATGACTCGAGTCATTCATGTTTGTAGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-396s1c1
Sequence:CCGGGCAGGGTTTCAATGGCACAATCTCGAGATTGTGCCATTGAAACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-1984s21c1
Sequence:CCGGCATTGGAAATTACATCCTATACTCGAGTATAGGATGTAATTTCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008444
KIF3B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 3B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008444.4-2609s21c1
Sequence:CCGGAGAATGCATGGGTAAGGTAAACTCGAGTTTACCTTACCCATGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-802s21c1
Sequence:CCGGGCAATCTTTGTTATCACTATTCTCGAGAATAGTGATAACAAAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-1892s21c1
Sequence:CCGGTAAAGCTCAAGCATCTTATTACTCGAGTAATAAGATGCTTGAGCTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-410s21c1
Sequence:CCGGAGGGTTTCAATGGCACAATTTCTCGAGAAATTGTGCCATTGAAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-850s1c1
Sequence:CCGGCGGGTAGGAAAGCTGAATCTTCTCGAGAAGATTCAGCTTTCCTACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-1971s1c1
Sequence:CCGGCCATTGGAAATTACATCCTATCTCGAGATAGGATGTAATTTCCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008444.2-2732s1c1
Sequence:CCGGCCTCCCTTCTTGTTAAACAATCTCGAGATTGTTTAACAAGAAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-750s1c1
Sequence:CCGGCGGTGCTACAAACATGAATGACTCGAGTCATTCATGTTTGTAGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008444.2-396s1c1
Sequence:CCGGGCAGGGTTTCAATGGCACAATCTCGAGATTGTGCCATTGAAACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008444.4-1984s21c1
Sequence:CCGGCATTGGAAATTACATCCTATACTCGAGTATAGGATGTAATTTCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004798
VALIDATED
KIF3B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 3B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004798.2-802s21c1
Sequence:CCGGGCTCGCGTTCTCATGCAATTTCTCGAGAAATTGCATGAGAACGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-2054s21c1
Sequence:CCGGAGTCTCAGCCGTGGGATATAACTCGAGTTATATCCCACGGCTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-1122s21c1
Sequence:CCGGCCTGCCTCTTACAACGTAGAACTCGAGTTCTACGTTGTAAGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004798.2-1122s1c1
Sequence:CCGGCCTGCCTCTTACAACGTAGAACTCGAGTTCTACGTTGTAAGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004798.2-2090s1c1
Sequence:CCGGGCACGCAAGAATGTCCATGATCTCGAGATCATGGACATTCTTGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004798.2-1727s1c1
Sequence:CCGGCTTGGAACTTAAAGAGACATACTCGAGTATGTCTCTTTAAGTTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-2113s21c1
Sequence:CCGGTTCGTCCAGAGGCCCGATATACTCGAGTATATCGGGCCTCTGGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-4283s21c1
Sequence:CCGGGCCTGTTTGAATAAGAACAAACTCGAGTTTGTTCTTATTCAAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004798.2-4283s1c1
Sequence:CCGGGCCTGTTTGAATAAGAACAAACTCGAGTTTGTTCTTATTCAAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004798.2-802s1c1
Sequence:CCGGGCTCGCGTTCTCATGCAATTTCTCGAGAAATTGCATGAGAACGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004798
VALIDATED
KIF3B MISSION shRNA shRNA Plasmid DNA
kinesin family member 3B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004798.2-802s21c1
Sequence:CCGGGCTCGCGTTCTCATGCAATTTCTCGAGAAATTGCATGAGAACGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-2054s21c1
Sequence:CCGGAGTCTCAGCCGTGGGATATAACTCGAGTTATATCCCACGGCTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-1122s21c1
Sequence:CCGGCCTGCCTCTTACAACGTAGAACTCGAGTTCTACGTTGTAAGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004798.2-1122s1c1
Sequence:CCGGCCTGCCTCTTACAACGTAGAACTCGAGTTCTACGTTGTAAGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004798.2-2090s1c1
Sequence:CCGGGCACGCAAGAATGTCCATGATCTCGAGATCATGGACATTCTTGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004798.2-1727s1c1
Sequence:CCGGCTTGGAACTTAAAGAGACATACTCGAGTATGTCTCTTTAAGTTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-2113s21c1
Sequence:CCGGTTCGTCCAGAGGCCCGATATACTCGAGTATATCGGGCCTCTGGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-4283s21c1
Sequence:CCGGGCCTGTTTGAATAAGAACAAACTCGAGTTTGTTCTTATTCAAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004798.2-4283s1c1
Sequence:CCGGGCCTGTTTGAATAAGAACAAACTCGAGTTTGTTCTTATTCAAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004798.2-802s1c1
Sequence:CCGGGCTCGCGTTCTCATGCAATTTCTCGAGAAATTGCATGAGAACGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004798
VALIDATED
KIF3B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 3B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004798.2-802s21c1
Sequence:CCGGGCTCGCGTTCTCATGCAATTTCTCGAGAAATTGCATGAGAACGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-2054s21c1
Sequence:CCGGAGTCTCAGCCGTGGGATATAACTCGAGTTATATCCCACGGCTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-1122s21c1
Sequence:CCGGCCTGCCTCTTACAACGTAGAACTCGAGTTCTACGTTGTAAGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004798.2-1122s1c1
Sequence:CCGGCCTGCCTCTTACAACGTAGAACTCGAGTTCTACGTTGTAAGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004798.2-2090s1c1
Sequence:CCGGGCACGCAAGAATGTCCATGATCTCGAGATCATGGACATTCTTGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004798.2-1727s1c1
Sequence:CCGGCTTGGAACTTAAAGAGACATACTCGAGTATGTCTCTTTAAGTTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-2113s21c1
Sequence:CCGGTTCGTCCAGAGGCCCGATATACTCGAGTATATCGGGCCTCTGGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004798.2-4283s21c1
Sequence:CCGGGCCTGTTTGAATAAGAACAAACTCGAGTTTGTTCTTATTCAAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004798.2-4283s1c1
Sequence:CCGGGCCTGTTTGAATAAGAACAAACTCGAGTTTGTTCTTATTCAAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004798.2-802s1c1
Sequence:CCGGGCTCGCGTTCTCATGCAATTTCTCGAGAAATTGCATGAGAACGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)