EMAIL THIS PAGE TO A FRIEND

KIF3C

kinesin family member 3C

171 Gene Product Result for
UniProtKB ID: O14782, O43544, Q4ZG18, Q53SX5, Q562F7
Gene ID:
Mouse(16570) kinesin family member 3C
Rat(85248) kinesin family member 3C
fruit fly(43820) CG17461 gene product from transcript CG17461-RA
cow(777770) kinesin family member 3C
Horse(100055794) kinesin family member 3C
domestic cat(101085199) kinesin family member 3C
dog(482999) kinesin family member 3C
chicken(429432) kinesin family member 3C
domestic guinea pig(100721347) kinesin family member 3C
naked mole-rat(101722490) kinesin family member 3C
sheep(101109434) kinesin family member 3C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406059 Anti-KIF3C antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV33898 Anti-KIF3C antibody produced in rabbit affinity isolated antibody mouse, rat, dog, horse, pig, rabbit, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002254 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087011 MISSION® esiRNA esiRNA targeting mouse Kif3c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002254 Rosetta Predictions human pricing
NM_053486 Rosetta Predictions rat pricing
NM_008445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202777 predicted 1201
2 SASI_Hs01_00202778 predicted 828
3 SASI_Hs01_00202779 predicted 2253
4 SASI_Hs01_00202780 predicted 2815
5 SASI_Hs01_00202781 predicted 910
6 SASI_Hs01_00202782 predicted 831
7 SASI_Hs01_00202784 predicted 2418
8 SASI_Hs02_00333504 predicted 2687
9 SASI_Hs01_00202785 predicted 918
10 SASI_Hs01_00202786 predicted 2673
11 SASI_Hs01_00202783 predicted 2647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072236 predicted 339
2 SASI_Rn01_00072237 predicted 773
3 SASI_Rn01_00072238 predicted 730
4 SASI_Rn01_00072239 predicted 2114
5 SASI_Rn02_00266085 predicted 623
6 SASI_Rn01_00072241 predicted 1695
7 SASI_Rn01_00072243 predicted 670
8 SASI_Rn01_00072244 predicted 522
9 SASI_Rn01_00072245 predicted 1292
10 SASI_Rn02_00266086 predicted 1845
11 SASI_Rn01_00072240 predicted 350
12 SASI_Rn01_00072242 predicted 2097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122795 predicted 1501
2 SASI_Mm01_00122796 predicted 1400
3 SASI_Mm01_00122797 predicted 1120
4 SASI_Mm01_00122798 predicted 1545
5 SASI_Mm01_00122799 predicted 2070
6 SASI_Mm01_00122800 predicted 1109
7 SASI_Mm01_00122801 predicted 2468
8 SASI_Mm01_00122802 predicted 1529
9 SASI_Mm01_00122803 predicted 2866
10 SASI_Mm02_00313930 predicted 2484
11 SASI_Mm01_00122804 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008445
VALIDATED
KIF3C MISSION shRNA Bacterial Glycerol Stock
kinesin family member 3C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-2870s21c1
Sequence:CCGGGCCAAATGAAGAAGCGTCCAACTCGAGTTGGACGCTTCTTCATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008445.1-3016s1c1
Sequence:CCGGGCTTGGTTAGTGAGAAGAGATCTCGAGATCTCTTCTCACTAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008445.1-2446s1c1
Sequence:CCGGGCCAAATGAAGAAGCGTCCAACTCGAGTTGGACGCTTCTTCATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008445.1-2686s1c1
Sequence:CCGGCGTCCACAACTAAAGTGCGAACTCGAGTTCGCACTTTAGTTGTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008445.1-965s1c1
Sequence:CCGGCTCTTCCTTTGTCACCAAGAACTCGAGTTCTTGGTGACAAAGGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008445.1-2432s1c1
Sequence:CCGGTGGAGTGAATAACAGCCAAATCTCGAGATTTGGCTGTTATTCACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-2856s21c1
Sequence:CCGGTGGAGTGAATAACAGCCAAATCTCGAGATTTGGCTGTTATTCACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-2502s21c1
Sequence:CCGGGAAACGCCGTGAACGGGAAATCTCGAGATTTCCCGTTCACGGCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-3440s21c1
Sequence:CCGGGCTTGGTTAGTGAGAAGAGATCTCGAGATCTCTTCTCACTAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-1111s21c1
Sequence:CCGGGGTTTCAACGGCACCGTATTTCTCGAGAAATACGGTGCCGTTGAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008445
VALIDATED
KIF3C MISSION shRNA shRNA Plasmid DNA
kinesin family member 3C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-2870s21c1
Sequence:CCGGGCCAAATGAAGAAGCGTCCAACTCGAGTTGGACGCTTCTTCATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008445.1-3016s1c1
Sequence:CCGGGCTTGGTTAGTGAGAAGAGATCTCGAGATCTCTTCTCACTAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008445.1-2446s1c1
Sequence:CCGGGCCAAATGAAGAAGCGTCCAACTCGAGTTGGACGCTTCTTCATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008445.1-2686s1c1
Sequence:CCGGCGTCCACAACTAAAGTGCGAACTCGAGTTCGCACTTTAGTTGTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008445.1-965s1c1
Sequence:CCGGCTCTTCCTTTGTCACCAAGAACTCGAGTTCTTGGTGACAAAGGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008445.1-2432s1c1
Sequence:CCGGTGGAGTGAATAACAGCCAAATCTCGAGATTTGGCTGTTATTCACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-2856s21c1
Sequence:CCGGTGGAGTGAATAACAGCCAAATCTCGAGATTTGGCTGTTATTCACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-2502s21c1
Sequence:CCGGGAAACGCCGTGAACGGGAAATCTCGAGATTTCCCGTTCACGGCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-3440s21c1
Sequence:CCGGGCTTGGTTAGTGAGAAGAGATCTCGAGATCTCTTCTCACTAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-1111s21c1
Sequence:CCGGGGTTTCAACGGCACCGTATTTCTCGAGAAATACGGTGCCGTTGAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008445
VALIDATED
KIF3C MISSION shRNA Lentiviral Transduction Particles
kinesin family member 3C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-2870s21c1
Sequence:CCGGGCCAAATGAAGAAGCGTCCAACTCGAGTTGGACGCTTCTTCATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008445.1-3016s1c1
Sequence:CCGGGCTTGGTTAGTGAGAAGAGATCTCGAGATCTCTTCTCACTAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008445.1-2446s1c1
Sequence:CCGGGCCAAATGAAGAAGCGTCCAACTCGAGTTGGACGCTTCTTCATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008445.1-2686s1c1
Sequence:CCGGCGTCCACAACTAAAGTGCGAACTCGAGTTCGCACTTTAGTTGTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008445.1-965s1c1
Sequence:CCGGCTCTTCCTTTGTCACCAAGAACTCGAGTTCTTGGTGACAAAGGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008445.1-2432s1c1
Sequence:CCGGTGGAGTGAATAACAGCCAAATCTCGAGATTTGGCTGTTATTCACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-2856s21c1
Sequence:CCGGTGGAGTGAATAACAGCCAAATCTCGAGATTTGGCTGTTATTCACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-2502s21c1
Sequence:CCGGGAAACGCCGTGAACGGGAAATCTCGAGATTTCCCGTTCACGGCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-3440s21c1
Sequence:CCGGGCTTGGTTAGTGAGAAGAGATCTCGAGATCTCTTCTCACTAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008445.2-1111s21c1
Sequence:CCGGGGTTTCAACGGCACCGTATTTCTCGAGAAATACGGTGCCGTTGAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002254
VALIDATED
KIF3C MISSION shRNA Bacterial Glycerol Stock
kinesin family member 3C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2841s1c1
Sequence:CCGGCTCATGCGATTGGACAGCTTTCTCGAGAAAGCTGTCCAATCGCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2905s21c1
Sequence:CCGGGAAAGACCTTCCACGTCTAAACTCGAGTTTAGACGTGGAAGGTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2467s21c1
Sequence:CCGGGACCAGCATGATGAGTATATCCTCGAGGATATACTCATCATGCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002254.5-4272s1c1
Sequence:CCGGCGAGTGAATTAGGATTTCAAACTCGAGTTTGAAATCCTAATTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2222s1c1
Sequence:CCGGGCAGAAGATGTTGGAACTGAACTCGAGTTCAGTTCCAACATCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2507s1c1
Sequence:CCGGGTACCTAATCATCGAGAACTTCTCGAGAAGTTCTCGATGATTAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2432s1c1
Sequence:CCGGGCATGATGAGTATATCCGCGTCTCGAGACGCGGATATACTCATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2262s21c1
Sequence:CCGGGCAGAAGATGTTGGAACTGAACTCGAGTTCAGTTCCAACATCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2547s21c1
Sequence:CCGGGTACCTAATCATCGAGAACTTCTCGAGAAGTTCTCGATGATTAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002254
VALIDATED
KIF3C MISSION shRNA shRNA Plasmid DNA
kinesin family member 3C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2841s1c1
Sequence:CCGGCTCATGCGATTGGACAGCTTTCTCGAGAAAGCTGTCCAATCGCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2905s21c1
Sequence:CCGGGAAAGACCTTCCACGTCTAAACTCGAGTTTAGACGTGGAAGGTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2467s21c1
Sequence:CCGGGACCAGCATGATGAGTATATCCTCGAGGATATACTCATCATGCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002254.5-4272s1c1
Sequence:CCGGCGAGTGAATTAGGATTTCAAACTCGAGTTTGAAATCCTAATTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2222s1c1
Sequence:CCGGGCAGAAGATGTTGGAACTGAACTCGAGTTCAGTTCCAACATCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2507s1c1
Sequence:CCGGGTACCTAATCATCGAGAACTTCTCGAGAAGTTCTCGATGATTAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2432s1c1
Sequence:CCGGGCATGATGAGTATATCCGCGTCTCGAGACGCGGATATACTCATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2262s21c1
Sequence:CCGGGCAGAAGATGTTGGAACTGAACTCGAGTTCAGTTCCAACATCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2547s21c1
Sequence:CCGGGTACCTAATCATCGAGAACTTCTCGAGAAGTTCTCGATGATTAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002254
VALIDATED
KIF3C MISSION shRNA Lentiviral Transduction Particles
kinesin family member 3C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2841s1c1
Sequence:CCGGCTCATGCGATTGGACAGCTTTCTCGAGAAAGCTGTCCAATCGCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2905s21c1
Sequence:CCGGGAAAGACCTTCCACGTCTAAACTCGAGTTTAGACGTGGAAGGTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2467s21c1
Sequence:CCGGGACCAGCATGATGAGTATATCCTCGAGGATATACTCATCATGCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002254.5-4272s1c1
Sequence:CCGGCGAGTGAATTAGGATTTCAAACTCGAGTTTGAAATCCTAATTCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2222s1c1
Sequence:CCGGGCAGAAGATGTTGGAACTGAACTCGAGTTCAGTTCCAACATCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2507s1c1
Sequence:CCGGGTACCTAATCATCGAGAACTTCTCGAGAAGTTCTCGATGATTAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002254.5-2432s1c1
Sequence:CCGGGCATGATGAGTATATCCGCGTCTCGAGACGCGGATATACTCATCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2262s21c1
Sequence:CCGGGCAGAAGATGTTGGAACTGAACTCGAGTTCAGTTCCAACATCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002254.6-2547s21c1
Sequence:CCGGGTACCTAATCATCGAGAACTTCTCGAGAAGTTCTCGATGATTAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)