EMAIL THIS PAGE TO A FRIEND

Kif4

14 Gene Product Result for
Species: Mouse Kif4(16571)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
K1765 Monoclonal Anti-KIF4 antibody produced in mouse ~1.5 mg/mL, clone 3E2, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunocytochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031151 MISSION® esiRNA targeting mouse Kif4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_008446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185334 predicted 430
2 SASI_Mm01_00185335 predicted 2476
3 SASI_Mm01_00185336 predicted 1101
4 SASI_Mm01_00185337 predicted 1359
5 SASI_Mm01_00185338 predicted 1007
6 SASI_Mm01_00185339 predicted 1759
7 SASI_Mm01_00185340 predicted 2987
8 SASI_Mm01_00185341 predicted 2042
9 SASI_Mm02_00313931 predicted 3967
10 SASI_Mm02_00313932 predicted 626
11 SASI_Mm01_00185342 predicted 1186
12 SASI_Mm01_00185343 predicted 3337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008446
VALIDATED
Kif4 MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008446.2-3422s21c1
Sequence:CCGGCCATCTCACAAGAAATATCTTCTCGAGAAGATATTTCTTGTGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008446.2-4167s21c1
Sequence:CCGGGCACTAATGACTTCAGTAGTTCTCGAGAACTACTGAAGTCATTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008446.2-2025s21c1
Sequence:CCGGGCTAAGAAGATGACTCAGAATCTCGAGATTCTGAGTCATCTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008446.2-1527s21c1
Sequence:CCGGCCTGGAGATATAAATGTGGAACTCGAGTTCCACATTTATATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-1854s1c1
Sequence:CCGGCCTGGAGATATAAATGTGGAACTCGAGTTCCACATTTATATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008446.1-2352s1c1
Sequence:CCGGGCTAAGAAGATGACTCAGAATCTCGAGATTCTGAGTCATCTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-4090s1c1
Sequence:CCGGGCCATCAGAACCAGGACAATTCTCGAGAATTGTCCTGGTTCTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-3749s1c1
Sequence:CCGGCCATCTCACAAGAAATATCTTCTCGAGAAGATATTTCTTGTGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-4494s1c1
Sequence:CCGGGCACTAATGACTTCAGTAGTTCTCGAGAACTACTGAAGTCATTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008446
VALIDATED
Kif4 MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008446.2-3422s21c1
Sequence:CCGGCCATCTCACAAGAAATATCTTCTCGAGAAGATATTTCTTGTGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008446.2-4167s21c1
Sequence:CCGGGCACTAATGACTTCAGTAGTTCTCGAGAACTACTGAAGTCATTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008446.2-2025s21c1
Sequence:CCGGGCTAAGAAGATGACTCAGAATCTCGAGATTCTGAGTCATCTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008446.2-1527s21c1
Sequence:CCGGCCTGGAGATATAAATGTGGAACTCGAGTTCCACATTTATATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-1854s1c1
Sequence:CCGGCCTGGAGATATAAATGTGGAACTCGAGTTCCACATTTATATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008446.1-2352s1c1
Sequence:CCGGGCTAAGAAGATGACTCAGAATCTCGAGATTCTGAGTCATCTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-4090s1c1
Sequence:CCGGGCCATCAGAACCAGGACAATTCTCGAGAATTGTCCTGGTTCTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-3749s1c1
Sequence:CCGGCCATCTCACAAGAAATATCTTCTCGAGAAGATATTTCTTGTGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-4494s1c1
Sequence:CCGGGCACTAATGACTTCAGTAGTTCTCGAGAACTACTGAAGTCATTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008446
VALIDATED
Kif4 MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008446.2-3422s21c1
Sequence:CCGGCCATCTCACAAGAAATATCTTCTCGAGAAGATATTTCTTGTGAGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000309069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008446.2-4167s21c1
Sequence:CCGGGCACTAATGACTTCAGTAGTTCTCGAGAACTACTGAAGTCATTAGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000309135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008446.2-2025s21c1
Sequence:CCGGGCTAAGAAGATGACTCAGAATCTCGAGATTCTGAGTCATCTTCTTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000309067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008446.2-1527s21c1
Sequence:CCGGCCTGGAGATATAAATGTGGAACTCGAGTTCCACATTTATATCTCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-1854s1c1
Sequence:CCGGCCTGGAGATATAAATGTGGAACTCGAGTTCCACATTTATATCTCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008446.1-2352s1c1
Sequence:CCGGGCTAAGAAGATGACTCAGAATCTCGAGATTCTGAGTCATCTTCTTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-4090s1c1
Sequence:CCGGGCCATCAGAACCAGGACAATTCTCGAGAATTGTCCTGGTTCTGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-3749s1c1
Sequence:CCGGCCATCTCACAAGAAATATCTTCTCGAGAAGATATTTCTTGTGAGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008446.1-4494s1c1
Sequence:CCGGGCACTAATGACTTCAGTAGTTCTCGAGAACTACTGAAGTCATTAGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???