EMAIL THIS PAGE TO A FRIEND

KIF4A

kinesin family member 4A

95 Gene Product Result for
Synonyms: KIF4 KIF4G1
Gene ID:
Human(24137) Summary: This gene encodes a member of the kinesin 4 subfamily of kinesin related proteins. The encoded protein is an ATP dependent microtubule-based motor protein that is involved in the intracellular transport of membranous organelles. This protein also associates with condensed chromosome arms and may be involved in maintaining chromosome integrity during mitosis. This protein may also be involved in the organization of the central spindle prior to cytokinesis. A pseudogene of this gene is found on chromosome X.[provided by RefSeq, Mar 2010]
Rat(84393) kinesin family member 4A
sheep(101123442) kinesin family member 4A
domestic guinea pig(100715605) kinesin family member 4A
naked mole-rat(101705923) kinesin family member 4A
chicken(395823) kinesin family member 4A
cow(537127) kinesin family member 4A
Horse(100055648) kinesin family member 4A
domestic cat(101088393) kinesin family member 4A
dog(491941) kinesin family member 4A
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012310 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004681 MISSION® esiRNA esiRNA targeting human KIF4A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012310 Rosetta Predictions human pricing
XM_001058828 Rosetta Predictions rat pricing
XM_343797 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087629 predicted 345
2 SASI_Hs01_00087630 predicted 2959
3 SASI_Hs01_00087631 predicted 2828
4 SASI_Hs01_00087632 predicted 2829
5 SASI_Hs01_00087636 predicted 3693
6 SASI_Hs01_00087637 predicted 3694
7 SASI_Hs01_00087633 predicted 1026
8 SASI_Hs01_00087634 predicted 367
9 SASI_Hs01_00087635 predicted 3287
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290987 predicted 4498
2 SASI_Rn02_00290988 predicted 4295
3 SASI_Rn02_00290989 predicted 1690
4 SASI_Rn02_00290990 predicted 1135
5 SASI_Rn02_00290991 predicted 759
6 SASI_Rn02_00290992 predicted 1644
7 SASI_Rn02_00290993 predicted 2273
8 SASI_Rn02_00290994 predicted 1345
9 SASI_Rn02_00290995 predicted 954
10 SASI_Rn02_00290996 predicted 3867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396349 predicted 4493
2 SASI_Rn02_00396350 predicted 4292
3 SASI_Rn02_00396351 predicted 1686
4 SASI_Rn02_00396352 predicted 1138
5 SASI_Rn02_00396353 predicted 762
6 SASI_Rn02_00396354 predicted 1639
7 SASI_Rn02_00396355 predicted 2266
8 SASI_Rn02_00396356 predicted 1346
9 SASI_Rn02_00396357 predicted 953
10 SASI_Rn02_00396358 predicted 3876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012310
VALIDATED
KIF4A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 4A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012310.2-1709s1c1
Sequence:CCGGTGCAGCCTATTCAGTACCAATCTCGAGATTGGTACTGAATAGGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012310.2-1746s1c1
Sequence:CCGGAGAGCCAGAATTAGAAGTCATCTCGAGATGACTTCTAATTCTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012310.2-2464s1c1
Sequence:CCGGCTTACTGAAGTGCGTGGTCAACTCGAGTTGACCACGCACTTCAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012310.2-4179s1c1
Sequence:CCGGCCTCAGGAATGAGGTTGTGATCTCGAGATCACAACCTCATTCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2516s21c1
Sequence:CCGGAGGCGTACATTCTCCCTTACTCTCGAGAGTAAGGGAGAATGTACGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2287s21c1
Sequence:CCGGACAACGGGAGGTTGCAGATAACTCGAGTTATCTGCAACCTCCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2536s21c1
Sequence:CCGGTGAAGTGCGTGGTCAAGTTTCCTCGAGGAAACTTGACCACGCACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2764s21c1
Sequence:CCGGACAGGTCAGCAAACTTGAAAGCTCGAGCTTTCAAGTTTGCTGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012310
VALIDATED
KIF4A MISSION shRNA shRNA Plasmid DNA
kinesin family member 4A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012310.2-1709s1c1
Sequence:CCGGTGCAGCCTATTCAGTACCAATCTCGAGATTGGTACTGAATAGGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012310.2-1746s1c1
Sequence:CCGGAGAGCCAGAATTAGAAGTCATCTCGAGATGACTTCTAATTCTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012310.2-2464s1c1
Sequence:CCGGCTTACTGAAGTGCGTGGTCAACTCGAGTTGACCACGCACTTCAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012310.2-4179s1c1
Sequence:CCGGCCTCAGGAATGAGGTTGTGATCTCGAGATCACAACCTCATTCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2516s21c1
Sequence:CCGGAGGCGTACATTCTCCCTTACTCTCGAGAGTAAGGGAGAATGTACGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2287s21c1
Sequence:CCGGACAACGGGAGGTTGCAGATAACTCGAGTTATCTGCAACCTCCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2536s21c1
Sequence:CCGGTGAAGTGCGTGGTCAAGTTTCCTCGAGGAAACTTGACCACGCACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2764s21c1
Sequence:CCGGACAGGTCAGCAAACTTGAAAGCTCGAGCTTTCAAGTTTGCTGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012310
VALIDATED
KIF4A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 4A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012310.2-1709s1c1
Sequence:CCGGTGCAGCCTATTCAGTACCAATCTCGAGATTGGTACTGAATAGGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012310.2-1746s1c1
Sequence:CCGGAGAGCCAGAATTAGAAGTCATCTCGAGATGACTTCTAATTCTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012310.2-2464s1c1
Sequence:CCGGCTTACTGAAGTGCGTGGTCAACTCGAGTTGACCACGCACTTCAGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012310.2-4179s1c1
Sequence:CCGGCCTCAGGAATGAGGTTGTGATCTCGAGATCACAACCTCATTCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2516s21c1
Sequence:CCGGAGGCGTACATTCTCCCTTACTCTCGAGAGTAAGGGAGAATGTACGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2287s21c1
Sequence:CCGGACAACGGGAGGTTGCAGATAACTCGAGTTATCTGCAACCTCCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2536s21c1
Sequence:CCGGTGAAGTGCGTGGTCAAGTTTCCTCGAGGAAACTTGACCACGCACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012310.3-2764s21c1
Sequence:CCGGACAGGTCAGCAAACTTGAAAGCTCGAGCTTTCAAGTTTGCTGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)