EMAIL THIS PAGE TO A FRIEND

KIF4B

kinesin family member 4B

54 Gene Product Result for
UniProtKB ID: Q2VIQ3
Gene ID:
Rat(299255) kinesin family member 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099293 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099293 Rosetta Predictions human pricing
XM_209695 Rosetta Predictions human pricing
XM_934740 Rosetta Predictions human pricing
XM_001065440 Rosetta Predictions rat pricing
XM_234487 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320449 predicted 2384
2 SASI_Hs02_00320450 predicted 497
3 SASI_Hs02_00320451 predicted 1632
4 SASI_Hs02_00320452 predicted 1816
5 SASI_Hs02_00320453 predicted 1615
6 SASI_Hs02_00320454 predicted 1702
7 SASI_Hs02_00320455 predicted 1060
8 SASI_Hs02_00320456 predicted 3740
9 SASI_Hs02_00320457 predicted 2370
10 SASI_Hs02_00320458 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278644 predicted 2334
2 SASI_Hs01_00278645 predicted 2473
3 SASI_Hs01_00278646 predicted 3679
4 SASI_Hs01_00278647 predicted 2336
5 SASI_Hs01_00278648 predicted 2259
6 SASI_Hs01_00278649 predicted 2313
7 SASI_Hs01_00278650 predicted 2798
8 SASI_Hs01_00278651 predicted 2950
9 SASI_Hs01_00278652 predicted 2499
10 SASI_Hs01_00278653 predicted 3609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259095 predicted 1477
2 SASI_Hs01_00259096 predicted 1303
3 SASI_Hs01_00259097 predicted 1291
4 SASI_Hs01_00259098 predicted 1380
5 SASI_Hs01_00259099 predicted 729
6 SASI_Hs01_00259100 predicted 740
7 SASI_Hs01_00259101 predicted 1428
8 SASI_Hs01_00259102 predicted 1461
9 SASI_Hs01_00259103 predicted 1466
10 SASI_Hs01_00259104 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314127 predicted 2089
2 SASI_Rn02_00314128 predicted 1612
3 SASI_Rn02_00314129 predicted 925
4 SASI_Rn02_00314130 predicted 2266
5 SASI_Rn02_00314131 predicted 273
6 SASI_Rn02_00314132 predicted 1363
7 SASI_Rn02_00314133 predicted 2436
8 SASI_Rn02_00314134 predicted 1698
9 SASI_Rn02_00314135 predicted 264
10 SASI_Rn02_00314136 predicted 3163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388519 predicted 2084
2 SASI_Rn02_00388520 predicted 1611
3 SASI_Rn02_00388521 predicted 926
4 SASI_Rn02_00388522 predicted 3241
5 SASI_Rn02_00388523 predicted 2263
6 SASI_Rn02_00388524 predicted 271
7 SASI_Rn02_00388525 predicted 1361
8 SASI_Rn02_00388526 predicted 2437
9 SASI_Rn02_00388527 predicted 1696
10 SASI_Rn02_00388528 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099293
KIF4B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 4B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-2358s21c1
Sequence:CCGGGCCATGGAAAGGAAGGTATTGCTCGAGCAATACCTTCCTTTCCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-497s21c1
Sequence:CCGGGGCATTATTCCTAGGGTAATACTCGAGTATTACCCTAGGAATAATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099293.1-4145s21c1
Sequence:CCGGTGATCAAGTTCCTTCTTATTTCTCGAGAAATAAGAAGGAACTTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-2320s21c1
Sequence:CCGGACAACGAGAGGTCACAGATAACTCGAGTTATCTGTGACCTCTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-2061s21c1
Sequence:CCGGCCAAGCTGAACCAAGAGATATCTCGAGATATCTCTTGGTTCAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099293
KIF4B MISSION shRNA shRNA Plasmid DNA
kinesin family member 4B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-2358s21c1
Sequence:CCGGGCCATGGAAAGGAAGGTATTGCTCGAGCAATACCTTCCTTTCCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-497s21c1
Sequence:CCGGGGCATTATTCCTAGGGTAATACTCGAGTATTACCCTAGGAATAATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099293.1-4145s21c1
Sequence:CCGGTGATCAAGTTCCTTCTTATTTCTCGAGAAATAAGAAGGAACTTGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-2320s21c1
Sequence:CCGGACAACGAGAGGTCACAGATAACTCGAGTTATCTGTGACCTCTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-2061s21c1
Sequence:CCGGCCAAGCTGAACCAAGAGATATCTCGAGATATCTCTTGGTTCAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099293
KIF4B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 4B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-2358s21c1
Sequence:CCGGGCCATGGAAAGGAAGGTATTGCTCGAGCAATACCTTCCTTTCCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-497s21c1
Sequence:CCGGGGCATTATTCCTAGGGTAATACTCGAGTATTACCCTAGGAATAATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099293.1-4145s21c1
Sequence:CCGGTGATCAAGTTCCTTCTTATTTCTCGAGAAATAAGAAGGAACTTGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-2320s21c1
Sequence:CCGGACAACGAGAGGTCACAGATAACTCGAGTTATCTGTGACCTCTCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099293.1-2061s21c1
Sequence:CCGGCCAAGCTGAACCAAGAGATATCTCGAGATATCTCTTGGTTCAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)