EMAIL THIS PAGE TO A FRIEND

KIF5A

kinesin family member 5A

110 Gene Product Result for
Synonyms: D12S1889 MY050 NKHC SPG10
UniProtKB ID: Q12840, A6H8M5, Q4LE26
Gene ID:
Human(3798) Summary: This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
Mouse(16572) kinesin family member 5A
Rat(314906) kinesin family member 5A
dog(474416) kinesin family member 5A
Horse(100050542) kinesin family member 5A
cow(511273) kinesin family member 5A
domestic cat(101094768) kinesin family member 5A
domestic guinea pig(100720733) kinesin family member 5A
naked mole-rat(101711370) kinesin family member 5A
sheep(101119383) kinesin family member 5A
Domestic Rabbit(100339597) kinesin family member 5A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004984 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004984 Rosetta Predictions human pricing
NM_212523 Rosetta Predictions rat pricing
NM_001039000 Rosetta Predictions mouse pricing
NM_008447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122159 predicted 1628
2 SASI_Hs01_00122161 predicted 3098
3 SASI_Hs02_00338694 predicted 595
4 SASI_Hs01_00122163 predicted 3161
5 SASI_Hs01_00122164 predicted 2713
6 SASI_Hs01_00122166 predicted 2179
7 SASI_Hs01_00122167 predicted 679
8 SASI_Hs01_00122168 predicted 2944
9 SASI_Hs02_00338695 predicted 2796
10 SASI_Hs02_00338696 predicted 690
11 SASI_Hs01_00122160 predicted 2770
12 SASI_Hs01_00122162 predicted 2650
13 SASI_Hs01_00122165 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111252 predicted 2964
2 SASI_Rn01_00111253 predicted 2758
3 SASI_Rn01_00111254 predicted 2705
4 SASI_Rn02_00270547 predicted 1960
5 SASI_Rn01_00111255 predicted 2628
6 SASI_Rn01_00111256 predicted 2170
7 SASI_Rn01_00111258 predicted 584
8 SASI_Rn01_00111259 predicted 823
9 SASI_Rn02_00270548 predicted 3167
10 SASI_Rn01_00111260 predicted 1292
11 SASI_Rn01_00111251 predicted 537
12 SASI_Rn01_00111257 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175495 predicted 705
2 SASI_Mm01_00175496 predicted 1939
3 SASI_Mm01_00175497 predicted 562
4 SASI_Mm01_00175498 predicted 2608
5 SASI_Mm01_00175499 predicted 2281
6 SASI_Mm01_00175500 predicted 2680
7 SASI_Mm01_00175501 predicted 2472
8 SASI_Mm01_00175502 predicted 1262
9 SASI_Mm01_00175503 predicted 1429
10 SASI_Mm01_00175504 predicted 2914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046843 predicted 711
2 SASI_Mm01_00046844 predicted 1944
3 SASI_Mm01_00046845 predicted 577
4 SASI_Mm01_00046846 predicted 2616
5 SASI_Mm01_00046847 predicted 2287
6 SASI_Mm01_00046848 predicted 2693
7 SASI_Mm01_00046849 predicted 2473
8 SASI_Mm01_00046850 predicted 1274
9 SASI_Mm01_00046851 predicted 1436
10 SASI_Mm01_00046852 predicted 2921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004984
KIF5A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 5A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-1464s21c1
Sequence:CCGGAGGAGATCCGCCGTCTCTATACTCGAGTATAGAGACGGCGGATCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-2125s21c1
Sequence:CCGGGATCCGCTCGCTTACGGAATACTCGAGTATTCCGTAAGCGAGCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-2770s21c1
Sequence:CCGGGCGTTGTGAGCTTCCTAAATTCTCGAGAATTTAGGAAGCTCACAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-2393s21c1
Sequence:CCGGGATGAGCTCAAAGACCTAAATCTCGAGATTTAGGTCTTTGAGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-1174s1c1
Sequence:CCGGGCGGGCAAAGACCATTAAGAACTCGAGTTCTTAATGGTCTTTGCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-958s1c1
Sequence:CCGGCGAGGCAAAGAATATCAACAACTCGAGTTGTTGATATTCTTTGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-1525s1c1
Sequence:CCGGCCAACTCATAGAGAAGCTCAACTCGAGTTGAGCTTCTCTATGAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-523s1c1
Sequence:CCGGGATGGGAATCATTCCTCGAATCTCGAGATTCGAGGAATGATTCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-2419s1c1
Sequence:CCGGGCTCCAGTTAGAGCTAGAGAACTCGAGTTCTCTAGCTCTAACTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004984
KIF5A MISSION shRNA shRNA Plasmid DNA
kinesin family member 5A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-1464s21c1
Sequence:CCGGAGGAGATCCGCCGTCTCTATACTCGAGTATAGAGACGGCGGATCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-2125s21c1
Sequence:CCGGGATCCGCTCGCTTACGGAATACTCGAGTATTCCGTAAGCGAGCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-2770s21c1
Sequence:CCGGGCGTTGTGAGCTTCCTAAATTCTCGAGAATTTAGGAAGCTCACAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-2393s21c1
Sequence:CCGGGATGAGCTCAAAGACCTAAATCTCGAGATTTAGGTCTTTGAGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-1174s1c1
Sequence:CCGGGCGGGCAAAGACCATTAAGAACTCGAGTTCTTAATGGTCTTTGCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-958s1c1
Sequence:CCGGCGAGGCAAAGAATATCAACAACTCGAGTTGTTGATATTCTTTGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-1525s1c1
Sequence:CCGGCCAACTCATAGAGAAGCTCAACTCGAGTTGAGCTTCTCTATGAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-523s1c1
Sequence:CCGGGATGGGAATCATTCCTCGAATCTCGAGATTCGAGGAATGATTCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-2419s1c1
Sequence:CCGGGCTCCAGTTAGAGCTAGAGAACTCGAGTTCTCTAGCTCTAACTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004984
KIF5A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 5A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-1464s21c1
Sequence:CCGGAGGAGATCCGCCGTCTCTATACTCGAGTATAGAGACGGCGGATCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-2125s21c1
Sequence:CCGGGATCCGCTCGCTTACGGAATACTCGAGTATTCCGTAAGCGAGCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-2770s21c1
Sequence:CCGGGCGTTGTGAGCTTCCTAAATTCTCGAGAATTTAGGAAGCTCACAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004984.2-2393s21c1
Sequence:CCGGGATGAGCTCAAAGACCTAAATCTCGAGATTTAGGTCTTTGAGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-1174s1c1
Sequence:CCGGGCGGGCAAAGACCATTAAGAACTCGAGTTCTTAATGGTCTTTGCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-958s1c1
Sequence:CCGGCGAGGCAAAGAATATCAACAACTCGAGTTGTTGATATTCTTTGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-1525s1c1
Sequence:CCGGCCAACTCATAGAGAAGCTCAACTCGAGTTGAGCTTCTCTATGAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-523s1c1
Sequence:CCGGGATGGGAATCATTCCTCGAATCTCGAGATTCGAGGAATGATTCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004984.2-2419s1c1
Sequence:CCGGGCTCCAGTTAGAGCTAGAGAACTCGAGTTCTCTAGCTCTAACTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008447
KIF5A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 5A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-580s21c1
Sequence:CCGGGGTATCTTACTTCGAGATTTACTCGAGTAAATCTCGAAGTAAGATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-212s21c1
Sequence:CCGGATCAAGGTGCTTTGCCGATTTCTCGAGAAATCGGCAAAGCACCTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-381s21c1
Sequence:CCGGGTGCCATGCAGATCGTCAAAGCTCGAGCTTTGACGATCTGCATGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-2746s21c1
Sequence:CCGGGCGTTGTGAGCTTCCTAAATTCTCGAGAATTTAGGAAGCTCACAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-2843s21c1
Sequence:CCGGATGAAGGACAAGCGTAGATACCTCGAGGTATCTACGCTTGTCCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008447.2-3840s1c1
Sequence:CCGGCCAAACAGAAACATTTGCTAACTCGAGTTAGCAAATGTTTCTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-1451s1c1
Sequence:CCGGCGTCTCTACAAGCAGCTTGATCTCGAGATCAAGCTGCTTGTAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-2573s1c1
Sequence:CCGGCTTCGCAAGCTGTTCGTTCAACTCGAGTTGAACGAACAGCTTGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-3007s1c1
Sequence:CCGGCGAGTGTATCAGCTACACCAACTCGAGTTGGTGTAGCTGATACACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-3146s1c1
Sequence:CCGGGCCAACATGGACAATGGAAATCTCGAGATTTCCATTGTCCATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008447
KIF5A MISSION shRNA shRNA Plasmid DNA
kinesin family member 5A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-580s21c1
Sequence:CCGGGGTATCTTACTTCGAGATTTACTCGAGTAAATCTCGAAGTAAGATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-212s21c1
Sequence:CCGGATCAAGGTGCTTTGCCGATTTCTCGAGAAATCGGCAAAGCACCTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-381s21c1
Sequence:CCGGGTGCCATGCAGATCGTCAAAGCTCGAGCTTTGACGATCTGCATGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-2746s21c1
Sequence:CCGGGCGTTGTGAGCTTCCTAAATTCTCGAGAATTTAGGAAGCTCACAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-2843s21c1
Sequence:CCGGATGAAGGACAAGCGTAGATACCTCGAGGTATCTACGCTTGTCCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008447.2-3840s1c1
Sequence:CCGGCCAAACAGAAACATTTGCTAACTCGAGTTAGCAAATGTTTCTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-1451s1c1
Sequence:CCGGCGTCTCTACAAGCAGCTTGATCTCGAGATCAAGCTGCTTGTAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-2573s1c1
Sequence:CCGGCTTCGCAAGCTGTTCGTTCAACTCGAGTTGAACGAACAGCTTGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-3007s1c1
Sequence:CCGGCGAGTGTATCAGCTACACCAACTCGAGTTGGTGTAGCTGATACACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-3146s1c1
Sequence:CCGGGCCAACATGGACAATGGAAATCTCGAGATTTCCATTGTCCATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008447
KIF5A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 5A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-580s21c1
Sequence:CCGGGGTATCTTACTTCGAGATTTACTCGAGTAAATCTCGAAGTAAGATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-212s21c1
Sequence:CCGGATCAAGGTGCTTTGCCGATTTCTCGAGAAATCGGCAAAGCACCTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-381s21c1
Sequence:CCGGGTGCCATGCAGATCGTCAAAGCTCGAGCTTTGACGATCTGCATGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-2746s21c1
Sequence:CCGGGCGTTGTGAGCTTCCTAAATTCTCGAGAATTTAGGAAGCTCACAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008447.3-2843s21c1
Sequence:CCGGATGAAGGACAAGCGTAGATACCTCGAGGTATCTACGCTTGTCCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008447.2-3840s1c1
Sequence:CCGGCCAAACAGAAACATTTGCTAACTCGAGTTAGCAAATGTTTCTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-1451s1c1
Sequence:CCGGCGTCTCTACAAGCAGCTTGATCTCGAGATCAAGCTGCTTGTAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-2573s1c1
Sequence:CCGGCTTCGCAAGCTGTTCGTTCAACTCGAGTTGAACGAACAGCTTGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-3007s1c1
Sequence:CCGGCGAGTGTATCAGCTACACCAACTCGAGTTGGTGTAGCTGATACACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008447.2-3146s1c1
Sequence:CCGGGCCAACATGGACAATGGAAATCTCGAGATTTCCATTGTCCATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)