EMAIL THIS PAGE TO A FRIEND

KIF5B

kinesin family member 5B

54 Gene Product Result for
Synonyms: KINH KNS KNS1 UKHC
UniProtKB ID: P33176, A0AVB2, Q5VZ85
Gene ID:
Mouse(16573) kinesin family member 5B
Rat(117550) kinesin family member 5B
chicken(420472) kinesin family member 5B
domestic cat(101092693) kinesin family member 5B
cow(514261) kinesin family member 5B
Horse(100061228) kinesin family member 5B
dog(477968) kinesin family member 5B
domestic guinea pig(100727210) kinesin family member 5B
naked mole-rat(101718070) kinesin family member 5B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004521 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004521 Rosetta Predictions human pricing
NM_057202 Rosetta Predictions rat pricing
NM_008448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230168 predicted 2686
2 SASI_Hs01_00230169 predicted 632
3 SASI_Hs01_00230170 predicted 3206
4 SASI_Hs01_00230171 predicted 2057
5 SASI_Hs01_00230173 predicted 1725
6 SASI_Hs01_00230174 predicted 2914
7 SASI_Hs02_00337804 predicted 2275
8 SASI_Hs02_00337805 predicted 724
9 SASI_Hs01_00230175 predicted 2234
10 SASI_Hs01_00230176 predicted 2521
11 SASI_Hs01_00230172 predicted 1940
12 SASI_Hs01_00230177 predicted 2693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267154 predicted 1260
2 SASI_Rn01_00051023 predicted 1487
3 SASI_Rn01_00051025 predicted 1756
4 SASI_Rn01_00051026 predicted 2221
5 SASI_Rn01_00051027 predicted 2252
6 SASI_Rn01_00051028 predicted 1695
7 SASI_Rn01_00051029 predicted 2015
8 SASI_Rn01_00051030 predicted 377
9 SASI_Rn01_00051031 predicted 754
10 SASI_Rn01_00051032 predicted 1268
11 SASI_Rn01_00051024 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313933 predicted 3285
2 SASI_Mm02_00313934 predicted 523
3 SASI_Mm02_00313935 predicted 2323
4 SASI_Mm02_00313936 predicted 1649
5 SASI_Mm02_00313937 predicted 619
6 SASI_Mm02_00313938 predicted 3080
7 SASI_Mm02_00313939 predicted 450
8 SASI_Mm02_00313940 predicted 2154
9 SASI_Mm02_00313941 predicted 2785
10 SASI_Mm02_00313942 predicted 1146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008448
VALIDATED
KIF5B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 5B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-718s1c1
Sequence:CCGGCCAAGAATAGTGCAAGATATTCTCGAGAATATCTTGCACTATTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-471s1c1
Sequence:CCGGCGATAAGTACGTCGCCAAATTCTCGAGAATTTGGCGACGTACTTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-4231s1c1
Sequence:CCGGGCAGAGCTAATGTCATCTTTACTCGAGTAAAGATGACATTAGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-1211s1c1
Sequence:CCGGCCTATGTTCCTTATCGAGATACTCGAGTATCTCGATAAGGAACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-2974s1c1
Sequence:CCGGCCTAAGTTAGAGAAACGGCTTCTCGAGAAGCCGTTTCTCTAACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-3320s21c1
Sequence:CCGGGAAGTTTGAAGAGGACATAAACTCGAGTTTATGTCCTCTTCAAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-2974s21c1
Sequence:CCGGCCTAAGTTAGAGAAACGGCTTCTCGAGAAGCCGTTTCTCTAACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-1211s21c1
Sequence:CCGGCCTATGTTCCTTATCGAGATACTCGAGTATCTCGATAAGGAACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-718s21c1
Sequence:CCGGCCAAGAATAGTGCAAGATATTCTCGAGAATATCTTGCACTATTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-3348s21c1
Sequence:CCGGTTTCACTAACTAACCTCTATTCTCGAGAATAGAGGTTAGTTAGTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008448
VALIDATED
KIF5B MISSION shRNA shRNA Plasmid DNA
kinesin family member 5B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-718s1c1
Sequence:CCGGCCAAGAATAGTGCAAGATATTCTCGAGAATATCTTGCACTATTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-471s1c1
Sequence:CCGGCGATAAGTACGTCGCCAAATTCTCGAGAATTTGGCGACGTACTTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-4231s1c1
Sequence:CCGGGCAGAGCTAATGTCATCTTTACTCGAGTAAAGATGACATTAGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-1211s1c1
Sequence:CCGGCCTATGTTCCTTATCGAGATACTCGAGTATCTCGATAAGGAACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-2974s1c1
Sequence:CCGGCCTAAGTTAGAGAAACGGCTTCTCGAGAAGCCGTTTCTCTAACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-3320s21c1
Sequence:CCGGGAAGTTTGAAGAGGACATAAACTCGAGTTTATGTCCTCTTCAAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-2974s21c1
Sequence:CCGGCCTAAGTTAGAGAAACGGCTTCTCGAGAAGCCGTTTCTCTAACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-1211s21c1
Sequence:CCGGCCTATGTTCCTTATCGAGATACTCGAGTATCTCGATAAGGAACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-718s21c1
Sequence:CCGGCCAAGAATAGTGCAAGATATTCTCGAGAATATCTTGCACTATTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-3348s21c1
Sequence:CCGGTTTCACTAACTAACCTCTATTCTCGAGAATAGAGGTTAGTTAGTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008448
VALIDATED
KIF5B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 5B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-718s1c1
Sequence:CCGGCCAAGAATAGTGCAAGATATTCTCGAGAATATCTTGCACTATTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-471s1c1
Sequence:CCGGCGATAAGTACGTCGCCAAATTCTCGAGAATTTGGCGACGTACTTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-4231s1c1
Sequence:CCGGGCAGAGCTAATGTCATCTTTACTCGAGTAAAGATGACATTAGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-1211s1c1
Sequence:CCGGCCTATGTTCCTTATCGAGATACTCGAGTATCTCGATAAGGAACATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008448.2-2974s1c1
Sequence:CCGGCCTAAGTTAGAGAAACGGCTTCTCGAGAAGCCGTTTCTCTAACTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-3320s21c1
Sequence:CCGGGAAGTTTGAAGAGGACATAAACTCGAGTTTATGTCCTCTTCAAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-2974s21c1
Sequence:CCGGCCTAAGTTAGAGAAACGGCTTCTCGAGAAGCCGTTTCTCTAACTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-1211s21c1
Sequence:CCGGCCTATGTTCCTTATCGAGATACTCGAGTATCTCGATAAGGAACATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-718s21c1
Sequence:CCGGCCAAGAATAGTGCAAGATATTCTCGAGAATATCTTGCACTATTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008448.2-3348s21c1
Sequence:CCGGTTTCACTAACTAACCTCTATTCTCGAGAATAGAGGTTAGTTAGTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004521
VALIDATED
KIF5B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 5B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004521.1-3461s1c1
Sequence:CCGGGCCCTATTTATTACACAGTTTCTCGAGAAACTGTGTAATAAATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004521.1-842s1c1
Sequence:CCGGGATGAAGTTATGGATACCATACTCGAGTATGGTATCCATAACTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004521.1-1376s1c1
Sequence:CCGGCGGAACACTATTCAGTGGCTTCTCGAGAAGCCACTGAATAGTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004521.1-391s1c1
Sequence:CCGGCGACAAGTACATCGCCAAGTTCTCGAGAACTTGGCGATGTACTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004521.1-1904s1c1
Sequence:CCGGGCGAGTATAGATGCTGAGCTTCTCGAGAAGCTCAGCATCTATACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004521.2-3607s21c1
Sequence:CCGGTTACAACTGTGGCCCTATTTACTCGAGTAAATAGGGCCACAGTTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004521.2-1681s21c1
Sequence:CCGGCAACCGCAATTGGAGTTATAGCTCGAGCTATAACTCCAATTGCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004521.2-1272s21c1
Sequence:CCGGTTGGCTGAGGGTAGTACATATCTCGAGATATGTACTACCCTCAGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_004521.2-2049s21c1
Sequence:CCGGTCGGCAACTTTAGCGAGTATACTCGAGTATACTCGCTAAAGTTGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004521.2-684s21c1
Sequence:CCGGGATGTACTTGAAGGATATAATCTCGAGATTATATCCTTCAAGTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004521
VALIDATED
KIF5B MISSION shRNA shRNA Plasmid DNA
kinesin family member 5B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004521.1-3461s1c1
Sequence:CCGGGCCCTATTTATTACACAGTTTCTCGAGAAACTGTGTAATAAATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004521.1-842s1c1
Sequence:CCGGGATGAAGTTATGGATACCATACTCGAGTATGGTATCCATAACTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004521.1-1376s1c1
Sequence:CCGGCGGAACACTATTCAGTGGCTTCTCGAGAAGCCACTGAATAGTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004521.1-391s1c1
Sequence:CCGGCGACAAGTACATCGCCAAGTTCTCGAGAACTTGGCGATGTACTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004521.1-1904s1c1
Sequence:CCGGGCGAGTATAGATGCTGAGCTTCTCGAGAAGCTCAGCATCTATACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004521.2-3607s21c1
Sequence:CCGGTTACAACTGTGGCCCTATTTACTCGAGTAAATAGGGCCACAGTTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004521.2-1681s21c1
Sequence:CCGGCAACCGCAATTGGAGTTATAGCTCGAGCTATAACTCCAATTGCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004521.2-1272s21c1
Sequence:CCGGTTGGCTGAGGGTAGTACATATCTCGAGATATGTACTACCCTCAGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_004521.2-2049s21c1
Sequence:CCGGTCGGCAACTTTAGCGAGTATACTCGAGTATACTCGCTAAAGTTGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004521.2-684s21c1
Sequence:CCGGGATGTACTTGAAGGATATAATCTCGAGATTATATCCTTCAAGTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004521
VALIDATED
KIF5B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 5B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004521.1-3461s1c1
Sequence:CCGGGCCCTATTTATTACACAGTTTCTCGAGAAACTGTGTAATAAATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004521.1-842s1c1
Sequence:CCGGGATGAAGTTATGGATACCATACTCGAGTATGGTATCCATAACTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004521.1-1376s1c1
Sequence:CCGGCGGAACACTATTCAGTGGCTTCTCGAGAAGCCACTGAATAGTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004521.1-391s1c1
Sequence:CCGGCGACAAGTACATCGCCAAGTTCTCGAGAACTTGGCGATGTACTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004521.1-1904s1c1
Sequence:CCGGGCGAGTATAGATGCTGAGCTTCTCGAGAAGCTCAGCATCTATACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004521.2-3607s21c1
Sequence:CCGGTTACAACTGTGGCCCTATTTACTCGAGTAAATAGGGCCACAGTTGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004521.2-1681s21c1
Sequence:CCGGCAACCGCAATTGGAGTTATAGCTCGAGCTATAACTCCAATTGCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004521.2-1272s21c1
Sequence:CCGGTTGGCTGAGGGTAGTACATATCTCGAGATATGTACTACCCTCAGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_004521.2-2049s21c1
Sequence:CCGGTCGGCAACTTTAGCGAGTATACTCGAGTATACTCGCTAAAGTTGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004521.2-684s21c1
Sequence:CCGGGATGTACTTGAAGGATATAATCTCGAGATTATATCCTTCAAGTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)