EMAIL THIS PAGE TO A FRIEND

KIF5C

kinesin family member 5C

192 Gene Product Result for
Synonyms: KINN NKHC NKHC-2 NKHC2
UniProtKB ID: O60282, O95079, Q2YDC5
Gene ID:
Mouse(16574) kinesin family member 5C
Rat(311024) kinesin family member 5C
Zebrafish(565563) kinesin family member 5C
domestic cat(101098883) kinesin family member 5C
cow(538771) kinesin family member 5C
Horse(100056413) kinesin family member 5C
dog(476144) kinesin family member 5C
chicken(408046) kinesin family member 5C
domestic guinea pig(100726706) kinesin family member 5C
naked mole-rat(101711539) kinesin family member 5C
sheep(101113663) kinesin family member 5C
Domestic Rabbit(100348141) kinesin family member 5C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004522 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004522 Rosetta Predictions human pricing
XM_377774 Rosetta Predictions human pricing
XM_930597 Rosetta Predictions human pricing
XM_930615 Rosetta Predictions human pricing
XM_930627 Rosetta Predictions human pricing
XM_930638 Rosetta Predictions human pricing
XM_930654 Rosetta Predictions human pricing
NM_001107730 Rosetta Predictions rat pricing
NM_008449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337806 predicted 2612
2 SASI_Hs02_00337807 predicted 2055
3 SASI_Hs02_00337808 predicted 2785
4 SASI_Hs02_00337809 predicted 2561
5 SASI_Hs02_00337810 predicted 2619
6 SASI_Hs02_00337811 predicted 1742
7 SASI_Hs02_00337812 predicted 2606
8 SASI_Hs02_00337813 predicted 2706
9 SASI_Hs02_00337814 predicted 2298
10 SASI_Hs02_00337815 predicted 1742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_377774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274279 predicted 1581
2 SASI_Hs01_00274280 predicted 1030
3 SASI_Hs01_00274281 predicted 1759
4 SASI_Hs01_00274282 predicted 1536
5 SASI_Hs01_00274283 predicted 1592
6 SASI_Hs01_00274284 predicted 724
7 SASI_Hs01_00274285 predicted 1583
8 SASI_Hs01_00274286 predicted 1687
9 SASI_Hs01_00274287 predicted 1268
10 SASI_Hs01_00274288 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261536 predicted 237
2 SASI_Hs01_00261537 predicted 239
3 SASI_Hs01_00261538 predicted 223
4 SASI_Hs01_00261539 predicted 213
5 SASI_Hs01_00261540 predicted 204
6 SASI_Hs01_00261541 predicted 215
7 SASI_Hs01_00261542 predicted 210
8 SASI_Hs01_00261543 predicted 217
9 SASI_Hs01_00261544 predicted 215
10 SASI_Hs01_00261545 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274547 predicted 1671
2 SASI_Hs01_00274548 predicted 1111
3 SASI_Hs01_00274549 predicted 1840
4 SASI_Hs01_00274550 predicted 1617
5 SASI_Hs01_00274551 predicted 1677
6 SASI_Hs01_00274552 predicted 806
7 SASI_Hs01_00274553 predicted 1668
8 SASI_Hs01_00274554 predicted 1765
9 SASI_Hs01_00274555 predicted 1350
10 SASI_Hs01_00274556 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281115 predicted 759
2 SASI_Hs01_00281116 predicted 911
3 SASI_Hs01_00281117 predicted 944
4 SASI_Hs01_00281118 predicted 962
5 SASI_Hs01_00281119 predicted 679
6 SASI_Hs01_00281120 predicted 758
7 SASI_Hs01_00281121 predicted 357
8 SASI_Hs01_00281122 predicted 673
9 SASI_Hs01_00281123 predicted 859
10 SASI_Hs01_00281124 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252778 predicted 516
2 SASI_Hs01_00252779 predicted 665
3 SASI_Hs01_00252780 predicted 689
4 SASI_Hs01_00252781 predicted 717
5 SASI_Hs01_00252782 predicted 426
6 SASI_Hs01_00252783 predicted 1460
7 SASI_Hs01_00252784 predicted 1538
8 SASI_Hs01_00252785 predicted 512
9 SASI_Hs01_00252786 predicted 442
10 SASI_Hs01_00252787 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272238 predicted 1716
2 SASI_Hs01_00272239 predicted 1153
3 SASI_Hs01_00272240 predicted 1883
4 SASI_Hs01_00272241 predicted 1660
5 SASI_Hs01_00272242 predicted 1713
6 SASI_Hs01_00272243 predicted 844
7 SASI_Hs01_00272244 predicted 1705
8 SASI_Hs01_00272245 predicted 1811
9 SASI_Hs01_00272246 predicted 1399
10 SASI_Hs01_00272247 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231705 predicted 571
2 SASI_Rn02_00231706 predicted 1709
3 SASI_Rn02_00231707 predicted 2723
4 SASI_Rn02_00231708 predicted 2654
5 SASI_Rn02_00231709 predicted 2762
6 SASI_Rn02_00231710 predicted 482
7 SASI_Rn02_00231711 predicted 534
8 SASI_Rn02_00231712 predicted 3278
9 SASI_Rn02_00231713 predicted 2751
10 SASI_Rn02_00231714 predicted 2272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144124 predicted 638
2 SASI_Mm01_00144125 predicted 2523
3 SASI_Mm01_00144126 predicted 3218
4 SASI_Mm01_00144128 predicted 1955
5 SASI_Mm01_00144129 predicted 539
6 SASI_Mm01_00144130 predicted 2031
7 SASI_Mm01_00144131 predicted 2740
8 SASI_Mm01_00144132 predicted 783
9 SASI_Mm01_00144133 predicted 3276
10 SASI_Mm02_00313943 predicted 2533
11 SASI_Mm01_00144127 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008449
VALIDATED
KIF5C MISSION shRNA Bacterial Glycerol Stock
kinesin family member 5C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-3039s21c1
Sequence:CCGGGCAGGAAGTAGATCGCATCAACTCGAGTTGATGCGATCTACTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-1617s21c1
Sequence:CCGGGTACCGACAGCTCGATGATAACTCGAGTTATCATCGAGCTGTCGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-677s21c1
Sequence:CCGGCAAGGATTGCACATGATATTTCTCGAGAAATATCATGTGCAATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-3930s21c1
Sequence:CCGGCCCAGTTGTTTGAACATCATTCTCGAGAATGATGTTCAAACAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-1780s21c1
Sequence:CCGGGCAGCTAAAGACGAAGTGAAACTCGAGTTTCACTTCGTCTTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-3930s1c1
Sequence:CCGGCCCAGTTGTTTGAACATCATTCTCGAGAATGATGTTCAAACAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-1783s1c1
Sequence:CCGGGCTAAAGACGAAGTGAAAGAACTCGAGTTCTTTCACTTCGTCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-3039s1c1
Sequence:CCGGGCAGGAAGTAGATCGCATCAACTCGAGTTGATGCGATCTACTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-928s1c1
Sequence:CCGGGCTGTGACAAACATGAACGAACTCGAGTTCGTTCATGTTTGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-1780s1c1
Sequence:CCGGGCAGCTAAAGACGAAGTGAAACTCGAGTTTCACTTCGTCTTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008449
VALIDATED
KIF5C MISSION shRNA shRNA Plasmid DNA
kinesin family member 5C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-3039s21c1
Sequence:CCGGGCAGGAAGTAGATCGCATCAACTCGAGTTGATGCGATCTACTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-1617s21c1
Sequence:CCGGGTACCGACAGCTCGATGATAACTCGAGTTATCATCGAGCTGTCGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-677s21c1
Sequence:CCGGCAAGGATTGCACATGATATTTCTCGAGAAATATCATGTGCAATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-3930s21c1
Sequence:CCGGCCCAGTTGTTTGAACATCATTCTCGAGAATGATGTTCAAACAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-1780s21c1
Sequence:CCGGGCAGCTAAAGACGAAGTGAAACTCGAGTTTCACTTCGTCTTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-3930s1c1
Sequence:CCGGCCCAGTTGTTTGAACATCATTCTCGAGAATGATGTTCAAACAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-1783s1c1
Sequence:CCGGGCTAAAGACGAAGTGAAAGAACTCGAGTTCTTTCACTTCGTCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-3039s1c1
Sequence:CCGGGCAGGAAGTAGATCGCATCAACTCGAGTTGATGCGATCTACTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-928s1c1
Sequence:CCGGGCTGTGACAAACATGAACGAACTCGAGTTCGTTCATGTTTGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-1780s1c1
Sequence:CCGGGCAGCTAAAGACGAAGTGAAACTCGAGTTTCACTTCGTCTTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008449
VALIDATED
KIF5C MISSION shRNA Lentiviral Transduction Particles
kinesin family member 5C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-3039s21c1
Sequence:CCGGGCAGGAAGTAGATCGCATCAACTCGAGTTGATGCGATCTACTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-1617s21c1
Sequence:CCGGGTACCGACAGCTCGATGATAACTCGAGTTATCATCGAGCTGTCGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-677s21c1
Sequence:CCGGCAAGGATTGCACATGATATTTCTCGAGAAATATCATGTGCAATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-3930s21c1
Sequence:CCGGCCCAGTTGTTTGAACATCATTCTCGAGAATGATGTTCAAACAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008449.2-1780s21c1
Sequence:CCGGGCAGCTAAAGACGAAGTGAAACTCGAGTTTCACTTCGTCTTTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-3930s1c1
Sequence:CCGGCCCAGTTGTTTGAACATCATTCTCGAGAATGATGTTCAAACAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-1783s1c1
Sequence:CCGGGCTAAAGACGAAGTGAAAGAACTCGAGTTCTTTCACTTCGTCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-3039s1c1
Sequence:CCGGGCAGGAAGTAGATCGCATCAACTCGAGTTGATGCGATCTACTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-928s1c1
Sequence:CCGGGCTGTGACAAACATGAACGAACTCGAGTTCGTTCATGTTTGTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008449.2-1780s1c1
Sequence:CCGGGCAGCTAAAGACGAAGTGAAACTCGAGTTTCACTTCGTCTTTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004522
KIF5C MISSION shRNA Bacterial Glycerol Stock
kinesin family member 5C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-585s21c1
Sequence:CCGGGATGTCCTTGAAGGTTATAACCTCGAGGTTATAACCTTCAAGGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-2790s21c1
Sequence:CCGGGATCTGACCACCCGAGTTAAACTCGAGTTTAACTCGGGTGGTCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-2523s21c1
Sequence:CCGGTCCAGACTCCGAGACGAAATTCTCGAGAATTTCGTCTCGGAGTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-2676s21c1
Sequence:CCGGCTCTTATTGCTCAACGATAAACTCGAGTTTATCGTTGAGCAATAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004522.1-4986s21c1
Sequence:CCGGTATACCTGCTCTACCATTATTCTCGAGAATAATGGTAGAGCAGGTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004522
KIF5C MISSION shRNA shRNA Plasmid DNA
kinesin family member 5C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-585s21c1
Sequence:CCGGGATGTCCTTGAAGGTTATAACCTCGAGGTTATAACCTTCAAGGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-2790s21c1
Sequence:CCGGGATCTGACCACCCGAGTTAAACTCGAGTTTAACTCGGGTGGTCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-2523s21c1
Sequence:CCGGTCCAGACTCCGAGACGAAATTCTCGAGAATTTCGTCTCGGAGTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-2676s21c1
Sequence:CCGGCTCTTATTGCTCAACGATAAACTCGAGTTTATCGTTGAGCAATAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004522.1-4986s21c1
Sequence:CCGGTATACCTGCTCTACCATTATTCTCGAGAATAATGGTAGAGCAGGTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004522
KIF5C MISSION shRNA Lentiviral Transduction Particles
kinesin family member 5C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-585s21c1
Sequence:CCGGGATGTCCTTGAAGGTTATAACCTCGAGGTTATAACCTTCAAGGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-2790s21c1
Sequence:CCGGGATCTGACCACCCGAGTTAAACTCGAGTTTAACTCGGGTGGTCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-2523s21c1
Sequence:CCGGTCCAGACTCCGAGACGAAATTCTCGAGAATTTCGTCTCGGAGTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004522.1-2676s21c1
Sequence:CCGGCTCTTATTGCTCAACGATAAACTCGAGTTTATCGTTGAGCAATAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004522.1-4986s21c1
Sequence:CCGGTATACCTGCTCTACCATTATTCTCGAGAATAATGGTAGAGCAGGTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)