EMAIL THIS PAGE TO A FRIEND

KIF7

kinesin family member 7

67 Gene Product Result for
Synonyms: ACLS HLS2 JBTS12 UNQ340
UniProtKB ID: Q2M1P5, Q3SXY0, Q6UXE9, Q8IW72
Gene ID:
Human(374654) Summary: This gene encodes a cilia-associated protein belonging to the kinesin family. This protein plays a role in the sonic hedgehog (SHH) signaling pathway through the regulation of GLI transcription factors. It functions as a negative regulator of the SHH pathway by preventing inappropriate activation of GLI2 in the absence of ligand, and as a positive regulator by preventing the processing of GLI3 into its repressor form. Mutations in this gene have been associated with various ciliopathies. [provided by RefSeq, Oct 2011]
Mouse(16576) kinesin family member 7
Rat(293047) kinesin family member 7
Zebrafish(544651) kinesin family member 7
chicken(415488) kinesin family member 7
dog(488734) kinesin family member 7
domestic cat(101090619) kinesin family member 7
domestic guinea pig(100728354) kinesin family member 7
naked mole-rat(101702427) kinesin family member 7
sheep(101103926) kinesin family member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198525 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_133575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016611 MISSION® esiRNA esiRNA targeting human KIF7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198525 Rosetta Predictions human pricing
XM_001065361 Rosetta Predictions rat pricing
XM_218828 Rosetta Predictions rat pricing
NM_010626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190387 predicted 2192
2 SASI_Hs01_00190388 predicted 2279
3 SASI_Hs01_00190389 predicted 1798
4 SASI_Hs01_00190392 predicted 780
5 SASI_Hs01_00190393 predicted 2197
6 SASI_Hs01_00190394 predicted 2834
7 SASI_Hs01_00190395 predicted 1077
8 SASI_Hs01_00190396 predicted 2266
9 SASI_Hs02_00372104 predicted 1805
10 SASI_Hs02_00372105 predicted 1801
11 SASI_Hs01_00190390 predicted 2455
12 SASI_Hs01_00190391 predicted 2781
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313867 predicted 3652
2 SASI_Rn02_00313868 predicted 3671
3 SASI_Rn02_00313869 predicted 2655
4 SASI_Rn02_00313870 predicted 2244
5 SASI_Rn02_00313871 predicted 1071
6 SASI_Rn02_00313872 predicted 3272
7 SASI_Rn02_00313873 predicted 1747
8 SASI_Rn02_00313874 predicted 1660
9 SASI_Rn02_00313875 predicted 3931
10 SASI_Rn02_00313876 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378102 predicted 369
2 SASI_Rn02_00378103 predicted 459
3 SASI_Rn02_00378104 predicted 2248
4 SASI_Rn02_00378105 predicted 1063
5 SASI_Rn02_00378106 predicted 1743
6 SASI_Rn02_00378107 predicted 1655
7 SASI_Rn02_00378108 predicted 1495
8 SASI_Rn02_00378109 predicted 387
9 SASI_Rn02_00378110 predicted 1924
10 SASI_Rn02_00378111 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318961 predicted 2680
2 SASI_Mm02_00318962 predicted 445
3 SASI_Mm02_00318963 predicted 3598
4 SASI_Mm02_00318964 predicted 3051
5 SASI_Mm02_00318965 predicted 3863
6 SASI_Mm02_00318966 predicted 2176
7 SASI_Mm02_00318967 predicted 3629
8 SASI_Mm02_00318968 predicted 982
9 SASI_Mm02_00318969 predicted 1537
10 SASI_Mm02_00318970 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198525
KIF7 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198525.2-4232s21c1
Sequence:CCGGCCCTCACTGGGATCAACAAATCTCGAGATTTGTTGATCCCAGTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198525.2-3669s21c1
Sequence:CCGGGGCCGTTACATGTGGATAAACCTCGAGGTTTATCCACATGTAACGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198525.2-3368s21c1
Sequence:CCGGAGCCCTCCTCTGCAAGTATTTCTCGAGAAATACTTGCAGAGGAGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198525.1-2877s1c1
Sequence:CCGGCCCACCACTTACTTCCATGAACTCGAGTTCATGGAAGTAAGTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-563s1c1
Sequence:CCGGGCGCAGAAATAGGATCAGCAACTCGAGTTGCTGATCCTATTTCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-1814s1c1
Sequence:CCGGTGAGTATAAGAATGAGGCCATCTCGAGATGGCCTCATTCTTATACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-782s1c1
Sequence:CCGGGCTGGCTATCAACATCCGCATCTCGAGATGCGGATGTTGATAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-1277s1c1
Sequence:CCGGGAAGATTAAGACGGAAGAGATCTCGAGATCTCTTCCGTCTTAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198525
KIF7 MISSION shRNA shRNA Plasmid DNA
kinesin family member 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198525.2-4232s21c1
Sequence:CCGGCCCTCACTGGGATCAACAAATCTCGAGATTTGTTGATCCCAGTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198525.2-3669s21c1
Sequence:CCGGGGCCGTTACATGTGGATAAACCTCGAGGTTTATCCACATGTAACGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198525.2-3368s21c1
Sequence:CCGGAGCCCTCCTCTGCAAGTATTTCTCGAGAAATACTTGCAGAGGAGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198525.1-2877s1c1
Sequence:CCGGCCCACCACTTACTTCCATGAACTCGAGTTCATGGAAGTAAGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-563s1c1
Sequence:CCGGGCGCAGAAATAGGATCAGCAACTCGAGTTGCTGATCCTATTTCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-1814s1c1
Sequence:CCGGTGAGTATAAGAATGAGGCCATCTCGAGATGGCCTCATTCTTATACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-782s1c1
Sequence:CCGGGCTGGCTATCAACATCCGCATCTCGAGATGCGGATGTTGATAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-1277s1c1
Sequence:CCGGGAAGATTAAGACGGAAGAGATCTCGAGATCTCTTCCGTCTTAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198525
KIF7 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198525.2-4232s21c1
Sequence:CCGGCCCTCACTGGGATCAACAAATCTCGAGATTTGTTGATCCCAGTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198525.2-3669s21c1
Sequence:CCGGGGCCGTTACATGTGGATAAACCTCGAGGTTTATCCACATGTAACGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198525.2-3368s21c1
Sequence:CCGGAGCCCTCCTCTGCAAGTATTTCTCGAGAAATACTTGCAGAGGAGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198525.1-2877s1c1
Sequence:CCGGCCCACCACTTACTTCCATGAACTCGAGTTCATGGAAGTAAGTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-563s1c1
Sequence:CCGGGCGCAGAAATAGGATCAGCAACTCGAGTTGCTGATCCTATTTCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-1814s1c1
Sequence:CCGGTGAGTATAAGAATGAGGCCATCTCGAGATGGCCTCATTCTTATACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-782s1c1
Sequence:CCGGGCTGGCTATCAACATCCGCATCTCGAGATGCGGATGTTGATAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198525.1-1277s1c1
Sequence:CCGGGAAGATTAAGACGGAAGAGATCTCGAGATCTCTTCCGTCTTAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133575
KIF7 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_133575.5-4386s1c1
Sequence:CCGGGCCCAGAGTTCTGGAGATAATCTCGAGATTATCTCCAGAACTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-1927s1c1
Sequence:CCGGCCTGCGTGCATTCTCATCAAACTCGAGTTTGATGAGAATGCACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-3232s1c1
Sequence:CCGGCGAGTACAAGAATGAGGCTATCTCGAGATAGCCTCATTCTTGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-1100s1c1
Sequence:CCGGCGTGCTCAGAACATCCGCAATCTCGAGATTGCGGATGTTCTGAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-1933s1c1
Sequence:CCGGTGCATTCTCATCAAATGGGATCTCGAGATCCCATTTGATGAGAATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133575
KIF7 MISSION shRNA shRNA Plasmid DNA
kinesin family member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_133575.5-4386s1c1
Sequence:CCGGGCCCAGAGTTCTGGAGATAATCTCGAGATTATCTCCAGAACTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-1927s1c1
Sequence:CCGGCCTGCGTGCATTCTCATCAAACTCGAGTTTGATGAGAATGCACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-3232s1c1
Sequence:CCGGCGAGTACAAGAATGAGGCTATCTCGAGATAGCCTCATTCTTGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-1100s1c1
Sequence:CCGGCGTGCTCAGAACATCCGCAATCTCGAGATTGCGGATGTTCTGAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-1933s1c1
Sequence:CCGGTGCATTCTCATCAAATGGGATCTCGAGATCCCATTTGATGAGAATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133575
KIF7 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_133575.5-4386s1c1
Sequence:CCGGGCCCAGAGTTCTGGAGATAATCTCGAGATTATCTCCAGAACTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-1927s1c1
Sequence:CCGGCCTGCGTGCATTCTCATCAAACTCGAGTTTGATGAGAATGCACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-3232s1c1
Sequence:CCGGCGAGTACAAGAATGAGGCTATCTCGAGATAGCCTCATTCTTGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-1100s1c1
Sequence:CCGGCGTGCTCAGAACATCCGCAATCTCGAGATTGCGGATGTTCTGAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133575.5-1933s1c1
Sequence:CCGGTGCATTCTCATCAAATGGGATCTCGAGATCCCATTTGATGAGAATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)