EMAIL THIS PAGE TO A FRIEND

KIF9

kinesin family member 9

135 Gene Product Result for
UniProtKB ID: Q9HAQ2, Q86Z28, Q9H8A4
Gene ID:
Mouse(16578) kinesin family member 9
Rat(501059) kinesin family member 9
sheep(101113963) kinesin family member 9
domestic guinea pig(100719449) kinesin family member 9
naked mole-rat(101709297) kinesin family member 9
chicken(420405) kinesin family member 9
cow(508574) kinesin family member 9
Horse(100064806) kinesin family member 9
domestic cat(101096958) kinesin family member 9
dog(476642) kinesin family member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022342 Rosetta Predictions human pricing
NM_182902 Rosetta Predictions human pricing
NM_182903 Rosetta Predictions human pricing
XM_001077207 Rosetta Predictions rat pricing
XM_576475 Rosetta Predictions rat pricing
NM_010628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025847 predicted 1025
2 SASI_Hs01_00025848 predicted 596
3 SASI_Hs01_00025849 predicted 599
4 SASI_Hs01_00025850 predicted 548
5 SASI_Hs01_00025851 predicted 276
6 SASI_Hs01_00025852 predicted 279
7 SASI_Hs01_00025853 predicted 578
8 SASI_Hs01_00025855 predicted 326
9 SASI_Hs02_00355624 predicted 472
10 SASI_Hs01_00025856 predicted 1017
11 SASI_Hs01_00025854 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022462 predicted 1067
2 SASI_Hs01_00022463 predicted 644
3 SASI_Hs01_00022464 predicted 641
4 SASI_Hs01_00022465 predicted 601
5 SASI_Hs01_00022466 predicted 320
6 SASI_Hs01_00022467 predicted 327
7 SASI_Hs01_00022468 predicted 625
8 SASI_Hs01_00022470 predicted 371
9 SASI_Hs02_00371000 predicted 518
10 SASI_Hs01_00022471 predicted 1066
11 SASI_Hs01_00022469 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241086 predicted 1021
2 SASI_Hs01_00241087 predicted 588
3 SASI_Hs01_00241088 predicted 600
4 SASI_Hs01_00241089 predicted 552
5 SASI_Hs01_00241090 predicted 274
6 SASI_Hs01_00241091 predicted 281
7 SASI_Hs01_00241092 predicted 574
8 SASI_Hs01_00241094 predicted 323
9 SASI_Hs02_00371001 predicted 475
10 SASI_Hs01_00241095 predicted 1019
11 SASI_Hs01_00241093 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356170 predicted 1137
2 SASI_Rn02_00356171 predicted 1172
3 SASI_Rn02_00356172 predicted 1656
4 SASI_Rn02_00356173 predicted 1969
5 SASI_Rn02_00356174 predicted 2360
6 SASI_Rn02_00356175 predicted 363
7 SASI_Rn02_00356176 predicted 1050
8 SASI_Rn02_00356177 predicted 1417
9 SASI_Rn02_00356178 predicted 1857
10 SASI_Rn02_00356179 predicted 1950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405446 predicted 1128
2 SASI_Rn02_00405447 predicted 1967
3 SASI_Rn02_00405448 predicted 1827
4 SASI_Rn02_00405449 predicted 2366
5 SASI_Rn02_00405450 predicted 360
6 SASI_Rn02_00405451 predicted 1054
7 SASI_Rn02_00405452 predicted 1858
8 SASI_Rn02_00405453 predicted 674
9 SASI_Rn02_00405454 predicted 1951
10 SASI_Rn02_00405455 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171775 predicted 1702
2 SASI_Mm01_00171776 predicted 1388
3 SASI_Mm01_00171777 predicted 1833
4 SASI_Mm01_00171778 predicted 308
5 SASI_Mm02_00318971 predicted 2429
6 SASI_Mm01_00171779 predicted 284
7 SASI_Mm01_00171780 predicted 1446
8 SASI_Mm01_00171781 predicted 2058
9 SASI_Mm01_00171782 predicted 2372
10 SASI_Mm01_00171783 predicted 1859
11 SASI_Mm01_00171774 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010628
KIF9 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010628.1-2535s1c1
Sequence:CCGGCCAAACCCAGAGAACACACAACTCGAGTTGTGTGTTCTCTGGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-475s1c1
Sequence:CCGGCCGTGTTTCCTACCTGGAAATCTCGAGATTTCCAGGTAGGAAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-107s1c1
Sequence:CCGGCCTACTGATGACTTTGCTCATCTCGAGATGAGCAAAGTCATCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-1620s1c1
Sequence:CCGGGCAAGGACTTTGATGTGGCTTCTCGAGAAGCCACATCAAAGTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-1385s1c1
Sequence:CCGGCGCAGGAAGTACACTCTCATACTCGAGTATGAGAGTGTACTTCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010628.3-1543s21c1
Sequence:CCGGTAGGTGAGCCCGATGGACAAACTCGAGTTTGTCCATCGGGCTCACCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010628.3-1590s21c1
Sequence:CCGGTCTGTCAAACCTGGGAAGAAACTCGAGTTTCTTCCCAGGTTTGACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010628.3-2548s21c1
Sequence:CCGGGGAAGCTGCTAAACCACATGCCTCGAGGCATGTGGTTTAGCAGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010628.3-2442s21c1
Sequence:CCGGACAGATCAGAAGCACAATTATCTCGAGATAATTGTGCTTCTGATCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010628
KIF9 MISSION shRNA shRNA Plasmid DNA
kinesin family member 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010628.1-2535s1c1
Sequence:CCGGCCAAACCCAGAGAACACACAACTCGAGTTGTGTGTTCTCTGGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-475s1c1
Sequence:CCGGCCGTGTTTCCTACCTGGAAATCTCGAGATTTCCAGGTAGGAAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-107s1c1
Sequence:CCGGCCTACTGATGACTTTGCTCATCTCGAGATGAGCAAAGTCATCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-1620s1c1
Sequence:CCGGGCAAGGACTTTGATGTGGCTTCTCGAGAAGCCACATCAAAGTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-1385s1c1
Sequence:CCGGCGCAGGAAGTACACTCTCATACTCGAGTATGAGAGTGTACTTCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010628.3-1543s21c1
Sequence:CCGGTAGGTGAGCCCGATGGACAAACTCGAGTTTGTCCATCGGGCTCACCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010628.3-1590s21c1
Sequence:CCGGTCTGTCAAACCTGGGAAGAAACTCGAGTTTCTTCCCAGGTTTGACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010628.3-2548s21c1
Sequence:CCGGGGAAGCTGCTAAACCACATGCCTCGAGGCATGTGGTTTAGCAGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010628.3-2442s21c1
Sequence:CCGGACAGATCAGAAGCACAATTATCTCGAGATAATTGTGCTTCTGATCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010628
KIF9 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010628.1-2535s1c1
Sequence:CCGGCCAAACCCAGAGAACACACAACTCGAGTTGTGTGTTCTCTGGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-475s1c1
Sequence:CCGGCCGTGTTTCCTACCTGGAAATCTCGAGATTTCCAGGTAGGAAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-107s1c1
Sequence:CCGGCCTACTGATGACTTTGCTCATCTCGAGATGAGCAAAGTCATCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-1620s1c1
Sequence:CCGGGCAAGGACTTTGATGTGGCTTCTCGAGAAGCCACATCAAAGTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010628.1-1385s1c1
Sequence:CCGGCGCAGGAAGTACACTCTCATACTCGAGTATGAGAGTGTACTTCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010628.3-1543s21c1
Sequence:CCGGTAGGTGAGCCCGATGGACAAACTCGAGTTTGTCCATCGGGCTCACCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010628.3-1590s21c1
Sequence:CCGGTCTGTCAAACCTGGGAAGAAACTCGAGTTTCTTCCCAGGTTTGACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010628.3-2548s21c1
Sequence:CCGGGGAAGCTGCTAAACCACATGCCTCGAGGCATGTGGTTTAGCAGCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010628.3-2442s21c1
Sequence:CCGGACAGATCAGAAGCACAATTATCTCGAGATAATTGTGCTTCTGATCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022342
KIF9 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022342.2-2248s1c1
Sequence:CCGGCGCCAGTACCTTAAAGGACAACTCGAGTTGTCCTTTAAGGTACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-1025s1c1
Sequence:CCGGGCCCAGTTAGAAGAAACGCTACTCGAGTAGCGTTTCTTCTAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-723s1c1
Sequence:CCGGCCATCTACTTAGAGGCCCATTCTCGAGAATGGGCCTCTAAGTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-472s1c1
Sequence:CCGGGCGTGTTTCCTACTTGGAAATCTCGAGATTTCCAAGTAGGAAACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-1026s1c1
Sequence:CCGGCCCAGTTAGAAGAAACGCTATCTCGAGATAGCGTTTCTTCTAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022342.4-596s21c1
Sequence:CCGGCAGGCCCTCGATGGCTATAATCTCGAGATTATAGCCATCGAGGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022342.4-1929s21c1
Sequence:CCGGGTAGTGAGATCAACCGAATTTCTCGAGAAATTCGGTTGATCTCACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022342.4-2473s21c1
Sequence:CCGGGATAGAGCAGAAGCATAATTACTCGAGTAATTATGCTTCTGCTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022342
KIF9 MISSION shRNA shRNA Plasmid DNA
kinesin family member 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022342.2-2248s1c1
Sequence:CCGGCGCCAGTACCTTAAAGGACAACTCGAGTTGTCCTTTAAGGTACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-1025s1c1
Sequence:CCGGGCCCAGTTAGAAGAAACGCTACTCGAGTAGCGTTTCTTCTAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-723s1c1
Sequence:CCGGCCATCTACTTAGAGGCCCATTCTCGAGAATGGGCCTCTAAGTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-472s1c1
Sequence:CCGGGCGTGTTTCCTACTTGGAAATCTCGAGATTTCCAAGTAGGAAACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-1026s1c1
Sequence:CCGGCCCAGTTAGAAGAAACGCTATCTCGAGATAGCGTTTCTTCTAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022342.4-596s21c1
Sequence:CCGGCAGGCCCTCGATGGCTATAATCTCGAGATTATAGCCATCGAGGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022342.4-1929s21c1
Sequence:CCGGGTAGTGAGATCAACCGAATTTCTCGAGAAATTCGGTTGATCTCACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022342.4-2473s21c1
Sequence:CCGGGATAGAGCAGAAGCATAATTACTCGAGTAATTATGCTTCTGCTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022342
KIF9 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022342.2-2248s1c1
Sequence:CCGGCGCCAGTACCTTAAAGGACAACTCGAGTTGTCCTTTAAGGTACTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-1025s1c1
Sequence:CCGGGCCCAGTTAGAAGAAACGCTACTCGAGTAGCGTTTCTTCTAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-723s1c1
Sequence:CCGGCCATCTACTTAGAGGCCCATTCTCGAGAATGGGCCTCTAAGTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-472s1c1
Sequence:CCGGGCGTGTTTCCTACTTGGAAATCTCGAGATTTCCAAGTAGGAAACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022342.2-1026s1c1
Sequence:CCGGCCCAGTTAGAAGAAACGCTATCTCGAGATAGCGTTTCTTCTAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022342.4-596s21c1
Sequence:CCGGCAGGCCCTCGATGGCTATAATCTCGAGATTATAGCCATCGAGGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022342.4-1929s21c1
Sequence:CCGGGTAGTGAGATCAACCGAATTTCTCGAGAAATTCGGTTGATCTCACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022342.4-2473s21c1
Sequence:CCGGGATAGAGCAGAAGCATAATTACTCGAGTAATTATGCTTCTGCTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)