EMAIL THIS PAGE TO A FRIEND

KIFC1

kinesin family member C1

41 Gene Product Result for
Synonyms: HSET KNSL2
Gene ID:
Mouse(100502766) kinesin family member C1
Rat(294286) kinesin family member C1
Zebrafish(30453) kinesin family member C1
cow(510995) kinesin family member C1
Horse(100061590) kinesin family member C1
domestic cat(101087231) kinesin family member C1
dog(607916) kinesin family member C1
chicken(417037) kinesin family member C1
sheep(101113367) kinesin family member C1
domestic guinea pig(100735390) kinesin family member C1
naked mole-rat(101715556) kinesin family member C1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002263 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148011 MISSION® esiRNA esiRNA human KIFC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002263 Rosetta Predictions human pricing
NM_001005878 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185148 predicted 730
2 SASI_Hs01_00185149 predicted 1819
3 SASI_Hs01_00185150 predicted 874
4 SASI_Hs01_00185151 predicted 860
5 SASI_Hs01_00185152 predicted 1289
6 SASI_Hs01_00185153 predicted 2216
7 SASI_Hs01_00185154 predicted 678
8 SASI_Hs01_00185155 predicted 1176
9 SASI_Hs01_00185156 predicted 1064
10 SASI_Hs01_00185157 predicted 2045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080300 predicted 1485
2 SASI_Rn01_00080301 predicted 1589
3 SASI_Rn01_00080302 predicted 1878
4 SASI_Rn01_00080304 predicted 1996
5 SASI_Rn01_00080305 predicted 1956
6 SASI_Rn02_00198453 predicted 362
7 SASI_Rn02_00198454 predicted 1967
8 SASI_Rn01_00080306 predicted 1607
9 SASI_Rn01_00080307 predicted 949
10 SASI_Rn01_00080308 predicted 1611
11 SASI_Rn01_00080299 predicted 2020
12 SASI_Rn01_00080303 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002263
KIFC1 MISSION shRNA Bacterial Glycerol Stock
kinesin family member C1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002263.1-2253s1c1
Sequence:CCGGTGTGTCCCTATGTCTATGTATCTCGAGATACATAGACATAGGGACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002263.1-309s1c1
Sequence:CCGGCCTGAGAAGAAACGGACAAGACTCGAGTCTTGTCCGTTTCTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002263.1-1659s1c1
Sequence:CCGGACTGTCACCAATGCTCGATATCTCGAGATATCGAGCATTGGTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-1150s21c1
Sequence:CCGGCAGGTGGAATTGCAGGAAGAACTCGAGTTCTTCCTGCAATTCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002263.3-2529s21c1
Sequence:CCGGGTGTGTGTCCCTATGTCTATGCTCGAGCATAGACATAGGGACACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-1943s21c1
Sequence:CCGGCTGTCACCAATGCTCGATATGCTCGAGCATATCGAGCATTGGTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-2209s21c1
Sequence:CCGGCGGGAAACACAGGCCATTAACCTCGAGGTTAATGGCCTGTGTTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-849s21c1
Sequence:CCGGACGTCCAGCCTGGGACTTAAACTCGAGTTTAAGTCCCAGGCTGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002263
KIFC1 MISSION shRNA shRNA Plasmid DNA
kinesin family member C1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002263.1-2253s1c1
Sequence:CCGGTGTGTCCCTATGTCTATGTATCTCGAGATACATAGACATAGGGACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002263.1-309s1c1
Sequence:CCGGCCTGAGAAGAAACGGACAAGACTCGAGTCTTGTCCGTTTCTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002263.1-1659s1c1
Sequence:CCGGACTGTCACCAATGCTCGATATCTCGAGATATCGAGCATTGGTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-1150s21c1
Sequence:CCGGCAGGTGGAATTGCAGGAAGAACTCGAGTTCTTCCTGCAATTCCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002263.3-2529s21c1
Sequence:CCGGGTGTGTGTCCCTATGTCTATGCTCGAGCATAGACATAGGGACACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-1943s21c1
Sequence:CCGGCTGTCACCAATGCTCGATATGCTCGAGCATATCGAGCATTGGTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-2209s21c1
Sequence:CCGGCGGGAAACACAGGCCATTAACCTCGAGGTTAATGGCCTGTGTTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-849s21c1
Sequence:CCGGACGTCCAGCCTGGGACTTAAACTCGAGTTTAAGTCCCAGGCTGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002263
KIFC1 MISSION shRNA Lentiviral Transduction Particles
kinesin family member C1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002263.1-2253s1c1
Sequence:CCGGTGTGTCCCTATGTCTATGTATCTCGAGATACATAGACATAGGGACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002263.1-309s1c1
Sequence:CCGGCCTGAGAAGAAACGGACAAGACTCGAGTCTTGTCCGTTTCTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002263.1-1659s1c1
Sequence:CCGGACTGTCACCAATGCTCGATATCTCGAGATATCGAGCATTGGTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-1150s21c1
Sequence:CCGGCAGGTGGAATTGCAGGAAGAACTCGAGTTCTTCCTGCAATTCCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002263.3-2529s21c1
Sequence:CCGGGTGTGTGTCCCTATGTCTATGCTCGAGCATAGACATAGGGACACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-1943s21c1
Sequence:CCGGCTGTCACCAATGCTCGATATGCTCGAGCATATCGAGCATTGGTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-2209s21c1
Sequence:CCGGCGGGAAACACAGGCCATTAACCTCGAGGTTAATGGCCTGTGTTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002263.3-849s21c1
Sequence:CCGGACGTCCAGCCTGGGACTTAAACTCGAGTTTAAGTCCCAGGCTGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)