EMAIL THIS PAGE TO A FRIEND

KIFC2

kinesin family member C2

57 Gene Product Result for
UniProtKB ID: Q96AC6
Gene ID:
Mouse(16581) kinesin family member C2
Rat(300053) kinesin family member C2
domestic guinea pig(100735252) kinesin family member C2
naked mole-rat(101715982) kinesin family member C2
sheep(101107533) kinesin family member C2
cow(789523) kinesin family member C2
domestic cat(101096949) kinesin family member C2
dog(475128) kinesin family member C2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145754 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145754 Rosetta Predictions human pricing
NM_198752 Rosetta Predictions rat pricing
NM_010630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067098 predicted 2612
2 SASI_Hs01_00067099 predicted 2955
3 SASI_Hs01_00067101 predicted 1114
4 SASI_Hs01_00067102 predicted 418
5 SASI_Hs01_00067103 predicted 1279
6 SASI_Hs01_00067104 predicted 515
7 SASI_Hs01_00067105 predicted 1479
8 SASI_Hs02_00365340 predicted 425
9 SASI_Hs01_00067107 predicted 1326
10 SASI_Hs02_00365341 predicted 2931
11 SASI_Hs01_00067100 predicted 1144
12 SASI_Hs01_00067106 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110414 predicted 1853
2 SASI_Rn01_00110415 predicted 737
3 SASI_Rn02_00269979 predicted 284
4 SASI_Rn01_00110416 predicted 2069
5 SASI_Rn01_00110417 predicted 678
6 SASI_Rn01_00110418 predicted 1838
7 SASI_Rn02_00269980 predicted 1470
8 SASI_Rn01_00110419 predicted 1332
9 SASI_Rn01_00110420 predicted 392
10 SASI_Rn02_00269981 predicted 1099
11 SASI_Rn01_00110421 predicted 617
12 SASI_Rn01_00110422 predicted 1803
13 SASI_Rn01_00110423 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138071 predicted 1321
2 SASI_Mm02_00318975 predicted 274
3 SASI_Mm02_00318976 predicted 1831
4 SASI_Mm01_00138072 predicted 1601
5 SASI_Mm01_00138074 predicted 479
6 SASI_Mm01_00138075 predicted 383
7 SASI_Mm02_00318977 predicted 507
8 SASI_Mm01_00138076 predicted 595
9 SASI_Mm01_00138077 predicted 1841
10 SASI_Mm01_00138078 predicted 212
11 SASI_Mm01_00138073 predicted 640
12 SASI_Mm01_00138079 predicted 736
13 SASI_Mm01_00138080 predicted 2432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145754
VALIDATED
KIFC2 MISSION shRNA Bacterial Glycerol Stock
kinesin family member C2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145754.2-1489s21c1
Sequence:CCGGGCTACAGCGTCTGCATCTTCACTCGAGTGAAGATGCAGACGCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145754.2-1786s21c1
Sequence:CCGGCATTGCACCAGATGCTGAAACCTCGAGGTTTCAGCATCTGGTGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145754.2-1639s21c1
Sequence:CCGGTCAGCATGGTGGAGATCTACACTCGAGTGTAGATCTCCACCATGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145754.2-2911s21c1
Sequence:CCGGCCATGTAGGGTGCAGTCTTTACTCGAGTAAAGACTGCACCCTACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145754.2-2751s1c1
Sequence:CCGGGCTTTCTCCTTATCACCATTTCTCGAGAAATGGTGATAAGGAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145754.2-1115s1c1
Sequence:CCGGCCGAGGTTTGGTCAGCACCTTCTCGAGAAGGTGCTGACCAAACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145754.2-1274s1c1
Sequence:CCGGGCCAGAACTCAAGGGAAATATCTCGAGATATTTCCCTTGAGTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145754.2-1272s1c1
Sequence:CCGGCTGCCAGAACTCAAGGGAAATCTCGAGATTTCCCTTGAGTTCTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145754.2-523s1c1
Sequence:CCGGCCTCTCCAGATGGATCCACATCTCGAGATGTGGATCCATCTGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145754
VALIDATED
KIFC2 MISSION shRNA shRNA Plasmid DNA
kinesin family member C2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145754.2-1489s21c1
Sequence:CCGGGCTACAGCGTCTGCATCTTCACTCGAGTGAAGATGCAGACGCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145754.2-1786s21c1
Sequence:CCGGCATTGCACCAGATGCTGAAACCTCGAGGTTTCAGCATCTGGTGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145754.2-1639s21c1
Sequence:CCGGTCAGCATGGTGGAGATCTACACTCGAGTGTAGATCTCCACCATGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145754.2-2911s21c1
Sequence:CCGGCCATGTAGGGTGCAGTCTTTACTCGAGTAAAGACTGCACCCTACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145754.2-2751s1c1
Sequence:CCGGGCTTTCTCCTTATCACCATTTCTCGAGAAATGGTGATAAGGAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145754.2-1115s1c1
Sequence:CCGGCCGAGGTTTGGTCAGCACCTTCTCGAGAAGGTGCTGACCAAACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145754.2-1274s1c1
Sequence:CCGGGCCAGAACTCAAGGGAAATATCTCGAGATATTTCCCTTGAGTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145754.2-1272s1c1
Sequence:CCGGCTGCCAGAACTCAAGGGAAATCTCGAGATTTCCCTTGAGTTCTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145754.2-523s1c1
Sequence:CCGGCCTCTCCAGATGGATCCACATCTCGAGATGTGGATCCATCTGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145754
VALIDATED
KIFC2 MISSION shRNA Lentiviral Transduction Particles
kinesin family member C2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145754.2-1489s21c1
Sequence:CCGGGCTACAGCGTCTGCATCTTCACTCGAGTGAAGATGCAGACGCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145754.2-1786s21c1
Sequence:CCGGCATTGCACCAGATGCTGAAACCTCGAGGTTTCAGCATCTGGTGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145754.2-1639s21c1
Sequence:CCGGTCAGCATGGTGGAGATCTACACTCGAGTGTAGATCTCCACCATGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145754.2-2911s21c1
Sequence:CCGGCCATGTAGGGTGCAGTCTTTACTCGAGTAAAGACTGCACCCTACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145754.2-2751s1c1
Sequence:CCGGGCTTTCTCCTTATCACCATTTCTCGAGAAATGGTGATAAGGAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145754.2-1115s1c1
Sequence:CCGGCCGAGGTTTGGTCAGCACCTTCTCGAGAAGGTGCTGACCAAACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145754.2-1274s1c1
Sequence:CCGGGCCAGAACTCAAGGGAAATATCTCGAGATATTTCCCTTGAGTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145754.2-1272s1c1
Sequence:CCGGCTGCCAGAACTCAAGGGAAATCTCGAGATTTCCCTTGAGTTCTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145754.2-523s1c1
Sequence:CCGGCCTCTCCAGATGGATCCACATCTCGAGATGTGGATCCATCTGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010630
KIFC2 MISSION shRNA Bacterial Glycerol Stock
kinesin family member C2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-149s1c1
Sequence:CCGGCCGGATCAATTCACATCAGAACTCGAGTTCTGATGTGAATTGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010630.1-2802s1c1
Sequence:CCGGCCCTACTTCCATTACACCAAACTCGAGTTTGGTGTAATGGAAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-728s1c1
Sequence:CCGGCACCTCACATTGGAGAACGAACTCGAGTTCGTTCTCCAATGTGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-1826s1c1
Sequence:CCGGGCCCTAGTTACGCTGACTTTACTCGAGTAAAGTCAGCGTAACTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-1166s1c1
Sequence:CCGGGCTAAGACTCAACTCTCAGAACTCGAGTTCTGAGAGTTGAGTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010630
KIFC2 MISSION shRNA shRNA Plasmid DNA
kinesin family member C2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-149s1c1
Sequence:CCGGCCGGATCAATTCACATCAGAACTCGAGTTCTGATGTGAATTGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010630.1-2802s1c1
Sequence:CCGGCCCTACTTCCATTACACCAAACTCGAGTTTGGTGTAATGGAAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-728s1c1
Sequence:CCGGCACCTCACATTGGAGAACGAACTCGAGTTCGTTCTCCAATGTGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-1826s1c1
Sequence:CCGGGCCCTAGTTACGCTGACTTTACTCGAGTAAAGTCAGCGTAACTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-1166s1c1
Sequence:CCGGGCTAAGACTCAACTCTCAGAACTCGAGTTCTGAGAGTTGAGTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010630
KIFC2 MISSION shRNA Lentiviral Transduction Particles
kinesin family member C2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-149s1c1
Sequence:CCGGCCGGATCAATTCACATCAGAACTCGAGTTCTGATGTGAATTGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010630.1-2802s1c1
Sequence:CCGGCCCTACTTCCATTACACCAAACTCGAGTTTGGTGTAATGGAAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-728s1c1
Sequence:CCGGCACCTCACATTGGAGAACGAACTCGAGTTCGTTCTCCAATGTGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-1826s1c1
Sequence:CCGGGCCCTAGTTACGCTGACTTTACTCGAGTAAAGTCAGCGTAACTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010630.1-1166s1c1
Sequence:CCGGGCTAAGACTCAACTCTCAGAACTCGAGTTCTGAGAGTTGAGTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)