EMAIL THIS PAGE TO A FRIEND

KIFC3

kinesin family member C3

48 Gene Product Result for
Gene ID:
Human(3801) Summary: KIFC3 belongs to the large superfamily of kinesins, molecular motors that use the energy of ATP hydrolysis to translocate cargoes along microtubules. Members share extensive homology within a globular domain containing the microtubule- and ATP-binding sites and have a coiled-coil stalk domain that mediates oligomerization. Different kinesin family members participate in specific and diverse motile processes, such as cell division, organelle transport, and nuclear movement (Hoang et al., 1998 [PubMed 9782090]
Mouse(16582) kinesin family member C3
Rat(307644) kinesin family member C3
Zebrafish(568367) kinesin family member C3
chicken(415630) kinesin family member C3
cow(539231) kinesin family member C3
domestic cat(101086770) kinesin family member C3
dog(487259) kinesin family member C3
sheep(101103342) kinesin family member C3
domestic guinea pig(100721161) kinesin family member C3
naked mole-rat(101721440) kinesin family member C3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005550 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005550 Rosetta Predictions human pricing
NM_001103352 Rosetta Predictions rat pricing
NM_010631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046906 predicted 2064
2 SASI_Hs01_00046907 predicted 2820
3 SASI_Hs01_00046908 predicted 544
4 SASI_Hs01_00046909 predicted 953
5 SASI_Hs01_00046911 predicted 1485
6 SASI_Hs01_00046912 predicted 1815
7 SASI_Hs01_00046913 predicted 1756
8 SASI_Hs01_00046914 predicted 1131
9 SASI_Hs02_00339794 predicted 2387
10 SASI_Hs02_00339795 predicted 1533
11 SASI_Hs01_00046905 predicted 2076
12 SASI_Hs01_00046910 predicted 2467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211514 predicted 596
2 SASI_Rn02_00211515 predicted 2511
3 SASI_Rn02_00211516 predicted 605
4 SASI_Rn02_00211517 predicted 2270
5 SASI_Rn02_00211518 predicted 2058
6 SASI_Rn02_00211519 predicted 2447
7 SASI_Rn02_00211520 predicted 941
8 SASI_Rn02_00211521 predicted 533
9 SASI_Rn02_00211522 predicted 1472
10 SASI_Rn02_00211523 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185239 predicted 2257
2 SASI_Mm01_00185240 predicted 2349
3 SASI_Mm01_00185241 predicted 894
4 SASI_Mm01_00185242 predicted 1432
5 SASI_Mm02_00318978 predicted 863
6 SASI_Mm01_00185243 predicted 492
7 SASI_Mm01_00185244 predicted 1548
8 SASI_Mm02_00318979 predicted 1076
9 SASI_Mm01_00185245 predicted 431
10 SASI_Mm01_00185246 predicted 1419
11 SASI_Mm01_00185247 predicted 1406
12 SASI_Mm01_00185248 predicted 2422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010631
VALIDATED
KIFC3 MISSION shRNA Bacterial Glycerol Stock
kinesin family member C3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010631.1-2358s1c1
Sequence:CCGGCCTACCATGAATGCAGGAGATCTCGAGATCTCCTGCATTCATGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010631.1-531s1c1
Sequence:CCGGCCCACCTGTTAAGTATGTCATCTCGAGATGACATACTTAACAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010631.1-1068s1c1
Sequence:CCGGGCTGCGCAAGAAATGCCATAACTCGAGTTATGGCATTTCTTGCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010631.1-1636s1c1
Sequence:CCGGGATGACATCAACAAGGTGTTTCTCGAGAAACACCTTGTTGATGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010631.1-2040s1c1
Sequence:CCGGGACTCTGTACTCCCTCAGATTCTCGAGAATCTGAGGGAGTACAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-1432s21c1
Sequence:CCGGGCTGCGCAAGAAATGCCATAACTCGAGTTATGGCATTTCTTGCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-2000s21c1
Sequence:CCGGGATGACATCAACAAGGTGTTTCTCGAGAAACACCTTGTTGATGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010631.2-3082s21c1
Sequence:CCGGTCAGAGGTCTGGGCTATATTTCTCGAGAAATATAGCCCAGACCTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-1368s21c1
Sequence:CCGGAGGCCATCGAGGAGGTTAATACTCGAGTATTAACCTCCTCGATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-2404s21c1
Sequence:CCGGGACTCTGTACTCCCTCAGATTCTCGAGAATCTGAGGGAGTACAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010631
VALIDATED
KIFC3 MISSION shRNA shRNA Plasmid DNA
kinesin family member C3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010631.1-2358s1c1
Sequence:CCGGCCTACCATGAATGCAGGAGATCTCGAGATCTCCTGCATTCATGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010631.1-531s1c1
Sequence:CCGGCCCACCTGTTAAGTATGTCATCTCGAGATGACATACTTAACAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010631.1-1068s1c1
Sequence:CCGGGCTGCGCAAGAAATGCCATAACTCGAGTTATGGCATTTCTTGCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010631.1-1636s1c1
Sequence:CCGGGATGACATCAACAAGGTGTTTCTCGAGAAACACCTTGTTGATGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010631.1-2040s1c1
Sequence:CCGGGACTCTGTACTCCCTCAGATTCTCGAGAATCTGAGGGAGTACAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-1432s21c1
Sequence:CCGGGCTGCGCAAGAAATGCCATAACTCGAGTTATGGCATTTCTTGCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-2000s21c1
Sequence:CCGGGATGACATCAACAAGGTGTTTCTCGAGAAACACCTTGTTGATGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010631.2-3082s21c1
Sequence:CCGGTCAGAGGTCTGGGCTATATTTCTCGAGAAATATAGCCCAGACCTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-1368s21c1
Sequence:CCGGAGGCCATCGAGGAGGTTAATACTCGAGTATTAACCTCCTCGATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-2404s21c1
Sequence:CCGGGACTCTGTACTCCCTCAGATTCTCGAGAATCTGAGGGAGTACAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010631
VALIDATED
KIFC3 MISSION shRNA Lentiviral Transduction Particles
kinesin family member C3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010631.1-2358s1c1
Sequence:CCGGCCTACCATGAATGCAGGAGATCTCGAGATCTCCTGCATTCATGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010631.1-531s1c1
Sequence:CCGGCCCACCTGTTAAGTATGTCATCTCGAGATGACATACTTAACAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010631.1-1068s1c1
Sequence:CCGGGCTGCGCAAGAAATGCCATAACTCGAGTTATGGCATTTCTTGCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010631.1-1636s1c1
Sequence:CCGGGATGACATCAACAAGGTGTTTCTCGAGAAACACCTTGTTGATGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010631.1-2040s1c1
Sequence:CCGGGACTCTGTACTCCCTCAGATTCTCGAGAATCTGAGGGAGTACAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-1432s21c1
Sequence:CCGGGCTGCGCAAGAAATGCCATAACTCGAGTTATGGCATTTCTTGCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-2000s21c1
Sequence:CCGGGATGACATCAACAAGGTGTTTCTCGAGAAACACCTTGTTGATGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010631.2-3082s21c1
Sequence:CCGGTCAGAGGTCTGGGCTATATTTCTCGAGAAATATAGCCCAGACCTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-1368s21c1
Sequence:CCGGAGGCCATCGAGGAGGTTAATACTCGAGTATTAACCTCCTCGATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010631.2-2404s21c1
Sequence:CCGGGACTCTGTACTCCCTCAGATTCTCGAGAATCTGAGGGAGTACAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005550
VALIDATED
KIFC3 MISSION shRNA Bacterial Glycerol Stock
kinesin family member C3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005550.2-2841s1c1
Sequence:CCGGTGCAAATTGCATGGGCGGAAACTCGAGTTTCCGCCCATGCAATTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005550.2-1709s1c1
Sequence:CCGGTCTTGCATTGATGGCTTCAATCTCGAGATTGAAGCCATCAATGCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005550.2-2428s1c1
Sequence:CCGGGACGCTCTATTCCCTCAAGTTCTCGAGAACTTGAGGGAATAGAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005550.2-1457s1c1
Sequence:CCGGCTGCGTAAGAAGTGCCACAATCTCGAGATTGTGGCACTTCTTACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005550.2-1303s1c1
Sequence:CCGGCAACGACTACAATGGGCTCAACTCGAGTTGAGCCCATTGTAGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-1914s21c1
Sequence:CCGGAGCGCTGCGGAGATCTACAATCTCGAGATTGTAGATCTCCGCAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-2834s21c1
Sequence:CCGGTTCAGAAGGAAACGGTGTCTCCTCGAGGAGACACCGTTTCCTTCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-1258s21c1
Sequence:CCGGTGAAGGCTGTGCACGAGAATCCTCGAGGATTCTCGTGCACAGCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005550.3-520s21c1
Sequence:CCGGACCTGAAGGAGAAGCTCATTACTCGAGTAATGAGCTTCTCCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-2056s21c1
Sequence:CCGGACGACATCAACAAGGTGTTTGCTCGAGCAAACACCTTGTTGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005550
VALIDATED
KIFC3 MISSION shRNA shRNA Plasmid DNA
kinesin family member C3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005550.2-2841s1c1
Sequence:CCGGTGCAAATTGCATGGGCGGAAACTCGAGTTTCCGCCCATGCAATTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005550.2-1709s1c1
Sequence:CCGGTCTTGCATTGATGGCTTCAATCTCGAGATTGAAGCCATCAATGCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005550.2-2428s1c1
Sequence:CCGGGACGCTCTATTCCCTCAAGTTCTCGAGAACTTGAGGGAATAGAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005550.2-1457s1c1
Sequence:CCGGCTGCGTAAGAAGTGCCACAATCTCGAGATTGTGGCACTTCTTACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005550.2-1303s1c1
Sequence:CCGGCAACGACTACAATGGGCTCAACTCGAGTTGAGCCCATTGTAGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-1914s21c1
Sequence:CCGGAGCGCTGCGGAGATCTACAATCTCGAGATTGTAGATCTCCGCAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-2834s21c1
Sequence:CCGGTTCAGAAGGAAACGGTGTCTCCTCGAGGAGACACCGTTTCCTTCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-1258s21c1
Sequence:CCGGTGAAGGCTGTGCACGAGAATCCTCGAGGATTCTCGTGCACAGCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005550.3-520s21c1
Sequence:CCGGACCTGAAGGAGAAGCTCATTACTCGAGTAATGAGCTTCTCCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-2056s21c1
Sequence:CCGGACGACATCAACAAGGTGTTTGCTCGAGCAAACACCTTGTTGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005550
VALIDATED
KIFC3 MISSION shRNA Lentiviral Transduction Particles
kinesin family member C3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005550.2-2841s1c1
Sequence:CCGGTGCAAATTGCATGGGCGGAAACTCGAGTTTCCGCCCATGCAATTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005550.2-1709s1c1
Sequence:CCGGTCTTGCATTGATGGCTTCAATCTCGAGATTGAAGCCATCAATGCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005550.2-2428s1c1
Sequence:CCGGGACGCTCTATTCCCTCAAGTTCTCGAGAACTTGAGGGAATAGAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005550.2-1457s1c1
Sequence:CCGGCTGCGTAAGAAGTGCCACAATCTCGAGATTGTGGCACTTCTTACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005550.2-1303s1c1
Sequence:CCGGCAACGACTACAATGGGCTCAACTCGAGTTGAGCCCATTGTAGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-1914s21c1
Sequence:CCGGAGCGCTGCGGAGATCTACAATCTCGAGATTGTAGATCTCCGCAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-2834s21c1
Sequence:CCGGTTCAGAAGGAAACGGTGTCTCCTCGAGGAGACACCGTTTCCTTCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-1258s21c1
Sequence:CCGGTGAAGGCTGTGCACGAGAATCCTCGAGGATTCTCGTGCACAGCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005550.3-520s21c1
Sequence:CCGGACCTGAAGGAGAAGCTCATTACTCGAGTAATGAGCTTCTCCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005550.3-2056s21c1
Sequence:CCGGACGACATCAACAAGGTGTTTGCTCGAGCAAACACCTTGTTGATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)