EMAIL THIS PAGE TO A FRIEND

KIN

KIN, antigenic determinant of recA protein homolog (mouse)

65 Gene Product Result for
Synonyms: BTCD KIN17
UniProtKB ID: O60870
Gene ID:
Human(22944) Summary: The protein encoded by this gene is a nuclear protein that forms intranuclear foci during proliferation and is redistributed in the nucleoplasm during the cell cycle. Short-wave ultraviolet light provokes the relocalization of the protein, suggesting its participation in the cellular response to DNA damage. Originally selected based on protein-binding with RecA antibodies, the mouse protein presents a limited similarity with a functional domain of the bacterial RecA protein, a characteristic shared by this human ortholog. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(16588) antigenic determinant of rec-A protein
Rat(689197) antigenic determinant of rec-A protein homolog (mouse)
sheep(101115052) KIN, antigenic determinant of recA protein homolog (mouse)
Domestic Rabbit(100345186) KIN, antigenic determinant of recA protein homolog (mouse)
domestic guinea pig(100725757) KIN, antigenic determinant of recA protein homolog (mouse)
naked mole-rat(101696289) KIN, antigenic determinant of recA protein homolog (mouse)
Zebrafish(555316) KIN, antigenic determinant of recA protein homolog (mouse)
cow(519670) KIN, antigenic determinant of recA protein homolog (mouse)
Horse(100057012) KIN, antigenic determinant of recA protein homolog (mouse)
domestic cat(101080298) KIN, antigenic determinant of recA protein homolog (mouse)
dog(478010) KIN, antigenic determinant of recA protein homolog (mouse)
chicken(419109) KIN, antigenic determinant of recA protein homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31690 Anti-KIN antibody produced in rabbit affinity isolated antibody rabbit, canine, bovine, guinea pig, human, horse, rat
immunohistochemistry, western blot pricing
AV32295 Anti-KIN antibody produced in rabbit IgG fraction of antiserum rat, canine, guinea pig, human, horse, bovine, mouse, rabbit
western blot pricing
HPA038700 Anti-KIN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012311 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012311 Rosetta Predictions human pricing
NM_001109529 Rosetta Predictions rat pricing
NM_025280 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179600 predicted 453
2 SASI_Hs01_00179601 predicted 1028
3 SASI_Hs01_00179602 predicted 1302
4 SASI_Hs01_00179605 predicted 817
5 SASI_Hs01_00179606 predicted 1295
6 SASI_Hs01_00179607 predicted 553
7 SASI_Hs01_00179608 predicted 425
8 SASI_Hs01_00179609 predicted 1098
9 SASI_Hs02_00344084 predicted 1016
10 SASI_Hs02_00344085 predicted 1147
11 SASI_Hs01_00179603 predicted 419
12 SASI_Hs01_00179604 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249299 predicted 967
2 SASI_Rn02_00249300 predicted 523
3 SASI_Rn02_00249301 predicted 450
4 SASI_Rn02_00249302 predicted 300
5 SASI_Rn02_00249303 predicted 690
6 SASI_Rn02_00249304 predicted 1142
7 SASI_Rn02_00249305 predicted 488
8 SASI_Rn02_00249306 predicted 877
9 SASI_Rn02_00249307 predicted 962
10 SASI_Rn02_00249308 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032064 predicted 624
2 SASI_Mm01_00032066 predicted 386
3 SASI_Mm01_00032067 predicted 495
4 SASI_Mm02_00327889 predicted 279
5 SASI_Mm02_00327890 predicted 734
6 SASI_Mm02_00327891 predicted 992
7 SASI_Mm01_00032070 predicted 1077
8 SASI_Mm01_00032071 predicted 199
9 SASI_Mm02_00327892 predicted 992
10 SASI_Mm01_00032072 predicted 230
11 SASI_Mm01_00032065 predicted 904
12 SASI_Mm01_00032068 predicted 1067
13 SASI_Mm01_00032069 predicted 336
14 SASI_Mm01_00032073 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025280
VALIDATED
KIN MISSION shRNA Bacterial Glycerol Stock
KIN, antigenic determinant of recA protein homolog (mouse)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025280.1-56s1c1
Sequence:CCGGGCCAATAGAATTAAGTCCAAACTCGAGTTTGGACTTAATTCTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025280.1-1150s1c1
Sequence:CCGGCAGAGTTGAAGGTATTCAATACTCGAGTATTGAATACCTTCAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025280.1-1222s1c1
Sequence:CCGGGAAACTGTGAAGCATCAAATTCTCGAGAATTTGATGCTTCACAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025280.1-467s1c1
Sequence:CCGGCGTCGGCAACTGGAATTAGAACTCGAGTTCTAATTCCAGTTGCCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025280.1-1149s1c1
Sequence:CCGGGCAGAGTTGAAGGTATTCAATCTCGAGATTGAATACCTTCAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025280.2-417s21c1
Sequence:CCGGCACCGAAAGGCTGGTACATTCCTCGAGGAATGTACCAGCCTTTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025280.2-1222s21c1
Sequence:CCGGGAAACTGTGAAGCATCAAATTCTCGAGAATTTGATGCTTCACAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025280.2-354s21c1
Sequence:CCGGGGGAGACACTGACCGACTTTACTCGAGTAAAGTCGGTCAGTGTCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025280.2-1150s21c1
Sequence:CCGGCAGAGTTGAAGGTATTCAATACTCGAGTATTGAATACCTTCAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025280.2-201s21c1
Sequence:CCGGCTCAGCAGTTTATGGATTATTCTCGAGAATAATCCATAAACTGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025280
VALIDATED
KIN MISSION shRNA shRNA Plasmid DNA
KIN, antigenic determinant of recA protein homolog (mouse)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025280.1-56s1c1
Sequence:CCGGGCCAATAGAATTAAGTCCAAACTCGAGTTTGGACTTAATTCTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025280.1-1150s1c1
Sequence:CCGGCAGAGTTGAAGGTATTCAATACTCGAGTATTGAATACCTTCAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025280.1-1222s1c1
Sequence:CCGGGAAACTGTGAAGCATCAAATTCTCGAGAATTTGATGCTTCACAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025280.1-467s1c1
Sequence:CCGGCGTCGGCAACTGGAATTAGAACTCGAGTTCTAATTCCAGTTGCCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025280.1-1149s1c1
Sequence:CCGGGCAGAGTTGAAGGTATTCAATCTCGAGATTGAATACCTTCAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025280.2-417s21c1
Sequence:CCGGCACCGAAAGGCTGGTACATTCCTCGAGGAATGTACCAGCCTTTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025280.2-1222s21c1
Sequence:CCGGGAAACTGTGAAGCATCAAATTCTCGAGAATTTGATGCTTCACAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025280.2-354s21c1
Sequence:CCGGGGGAGACACTGACCGACTTTACTCGAGTAAAGTCGGTCAGTGTCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025280.2-1150s21c1
Sequence:CCGGCAGAGTTGAAGGTATTCAATACTCGAGTATTGAATACCTTCAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025280.2-201s21c1
Sequence:CCGGCTCAGCAGTTTATGGATTATTCTCGAGAATAATCCATAAACTGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025280
VALIDATED
KIN MISSION shRNA Lentiviral Transduction Particles
KIN, antigenic determinant of recA protein homolog (mouse)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025280.1-56s1c1
Sequence:CCGGGCCAATAGAATTAAGTCCAAACTCGAGTTTGGACTTAATTCTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025280.1-1150s1c1
Sequence:CCGGCAGAGTTGAAGGTATTCAATACTCGAGTATTGAATACCTTCAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025280.1-1222s1c1
Sequence:CCGGGAAACTGTGAAGCATCAAATTCTCGAGAATTTGATGCTTCACAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025280.1-467s1c1
Sequence:CCGGCGTCGGCAACTGGAATTAGAACTCGAGTTCTAATTCCAGTTGCCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025280.1-1149s1c1
Sequence:CCGGGCAGAGTTGAAGGTATTCAATCTCGAGATTGAATACCTTCAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025280.2-417s21c1
Sequence:CCGGCACCGAAAGGCTGGTACATTCCTCGAGGAATGTACCAGCCTTTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025280.2-1222s21c1
Sequence:CCGGGAAACTGTGAAGCATCAAATTCTCGAGAATTTGATGCTTCACAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025280.2-354s21c1
Sequence:CCGGGGGAGACACTGACCGACTTTACTCGAGTAAAGTCGGTCAGTGTCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025280.2-1150s21c1
Sequence:CCGGCAGAGTTGAAGGTATTCAATACTCGAGTATTGAATACCTTCAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025280.2-201s21c1
Sequence:CCGGCTCAGCAGTTTATGGATTATTCTCGAGAATAATCCATAAACTGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012311
VALIDATED
KIN MISSION shRNA Bacterial Glycerol Stock
KIN, antigenic determinant of recA protein homolog (mouse)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_012311.x-216s1c1
Sequence:CCGGCCTCAGCAGTTTATGGATTATCTCGAGATAATCCATAAACTGCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_012311.x-976s1c1
Sequence:CCGGCTGTTGTGAAGATGATTGATTCTCGAGAATCAATCATCTTCACAACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_012311.x-1166s1c1
Sequence:CCGGAGGACGCAGAGTTGAAGGAATCTCGAGATTCCTTCAACTCTGCGTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012311.x-217s1c1
Sequence:CCGGCTCAGCAGTTTATGGATTATTCTCGAGAATAATCCATAAACTGCTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012311.x-1132s1c1
Sequence:CCGGCAGCTACTATCGTCATTGAAACTCGAGTTTCAATGACGATAGTAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012311.2-321s21c1
Sequence:CCGGCAACATTGTCTACAACGAATACTCGAGTATTCGTTGTAGACAATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012311.2-819s21c1
Sequence:GTACCGGGAAATCTGCACTGGATGAAATCTCGAGATTTCATCCAGTGCAGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012311.2-1400s21c1
Sequence:GTACCGGATGTCTCATGAGGTATCAAACCTCGAGGTTTGATACCTCATGAGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012311.2-645s21c1
Sequence:CCGGTGAAGAGAAAGTCACGTTTAACTCGAGTTAAACGTGACTTTCTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012311.2-231s21c1
Sequence:CCGGTCAGCAGTTTATGGATTATTTCTCGAGAAATAATCCATAAACTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012311
VALIDATED
KIN MISSION shRNA shRNA Plasmid DNA
KIN, antigenic determinant of recA protein homolog (mouse)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_012311.x-216s1c1
Sequence:CCGGCCTCAGCAGTTTATGGATTATCTCGAGATAATCCATAAACTGCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_012311.x-976s1c1
Sequence:CCGGCTGTTGTGAAGATGATTGATTCTCGAGAATCAATCATCTTCACAACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_012311.x-1166s1c1
Sequence:CCGGAGGACGCAGAGTTGAAGGAATCTCGAGATTCCTTCAACTCTGCGTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012311.x-217s1c1
Sequence:CCGGCTCAGCAGTTTATGGATTATTCTCGAGAATAATCCATAAACTGCTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012311.x-1132s1c1
Sequence:CCGGCAGCTACTATCGTCATTGAAACTCGAGTTTCAATGACGATAGTAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012311.2-321s21c1
Sequence:CCGGCAACATTGTCTACAACGAATACTCGAGTATTCGTTGTAGACAATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012311.2-819s21c1
Sequence:GTACCGGGAAATCTGCACTGGATGAAATCTCGAGATTTCATCCAGTGCAGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012311.2-1400s21c1
Sequence:GTACCGGATGTCTCATGAGGTATCAAACCTCGAGGTTTGATACCTCATGAGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012311.2-645s21c1
Sequence:CCGGTGAAGAGAAAGTCACGTTTAACTCGAGTTAAACGTGACTTTCTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012311.2-231s21c1
Sequence:CCGGTCAGCAGTTTATGGATTATTTCTCGAGAAATAATCCATAAACTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012311
VALIDATED
KIN MISSION shRNA Lentiviral Transduction Particles
KIN, antigenic determinant of recA protein homolog (mouse)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_012311.x-216s1c1
Sequence:CCGGCCTCAGCAGTTTATGGATTATCTCGAGATAATCCATAAACTGCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_012311.x-976s1c1
Sequence:CCGGCTGTTGTGAAGATGATTGATTCTCGAGAATCAATCATCTTCACAACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_012311.x-1166s1c1
Sequence:CCGGAGGACGCAGAGTTGAAGGAATCTCGAGATTCCTTCAACTCTGCGTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012311.x-217s1c1
Sequence:CCGGCTCAGCAGTTTATGGATTATTCTCGAGAATAATCCATAAACTGCTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012311.x-1132s1c1
Sequence:CCGGCAGCTACTATCGTCATTGAAACTCGAGTTTCAATGACGATAGTAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012311.2-321s21c1
Sequence:CCGGCAACATTGTCTACAACGAATACTCGAGTATTCGTTGTAGACAATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012311.2-819s21c1
Sequence:GTACCGGGAAATCTGCACTGGATGAAATCTCGAGATTTCATCCAGTGCAGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012311.2-1400s21c1
Sequence:GTACCGGATGTCTCATGAGGTATCAAACCTCGAGGTTTGATACCTCATGAGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012311.2-645s21c1
Sequence:CCGGTGAAGAGAAAGTCACGTTTAACTCGAGTTAAACGTGACTTTCTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012311.2-231s21c1
Sequence:CCGGTCAGCAGTTTATGGATTATTTCTCGAGAAATAATCCATAAACTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)