EMAIL THIS PAGE TO A FRIEND

KIR2DL2

killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2

11 Gene Product Result for
Synonyms: CD158B1 CD158b NKAT6 p58.2
Species: Human KIR2DL2(3803)
UniProtKB ID: P43627, C6EVR8, Q14951
Gene ID:
Human(3803) Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014219 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214910 predicted 910
2 SASI_Hs01_00214911 predicted 880
3 SASI_Hs01_00214912 predicted 879
4 SASI_Hs01_00214913 predicted 918
5 SASI_Hs01_00214914 predicted 911
6 SASI_Hs01_00214915 predicted 633
7 SASI_Hs01_00214916 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014219
KIR2DL2 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-705s1c1
Sequence:CCGGCCCACTGAACCAAGCTCTAAACTCGAGTTTAGAGCTTGGTTCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-657s1c1
Sequence:CCGGCCACTGCTTGTTTCTGTCATACTCGAGTATGACAGAAACAAGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-194s1c1
Sequence:CCGGGCACAGAGAAGGGAAGTTTAACTCGAGTTAAACTTCCCTTCTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-922s1c1
Sequence:CCGGCACAGTTGAATCACTGCGTTTCTCGAGAAACGCAGTGATTCAACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-859s1c1
Sequence:CCGGCAGGGAACAGAACAGCGAATACTCGAGTATTCGCTGTTCTGTTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014219
KIR2DL2 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-705s1c1
Sequence:CCGGCCCACTGAACCAAGCTCTAAACTCGAGTTTAGAGCTTGGTTCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-657s1c1
Sequence:CCGGCCACTGCTTGTTTCTGTCATACTCGAGTATGACAGAAACAAGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-194s1c1
Sequence:CCGGGCACAGAGAAGGGAAGTTTAACTCGAGTTAAACTTCCCTTCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-922s1c1
Sequence:CCGGCACAGTTGAATCACTGCGTTTCTCGAGAAACGCAGTGATTCAACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-859s1c1
Sequence:CCGGCAGGGAACAGAACAGCGAATACTCGAGTATTCGCTGTTCTGTTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014219
KIR2DL2 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-705s1c1
Sequence:CCGGCCCACTGAACCAAGCTCTAAACTCGAGTTTAGAGCTTGGTTCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-657s1c1
Sequence:CCGGCCACTGCTTGTTTCTGTCATACTCGAGTATGACAGAAACAAGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-194s1c1
Sequence:CCGGGCACAGAGAAGGGAAGTTTAACTCGAGTTAAACTTCCCTTCTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-922s1c1
Sequence:CCGGCACAGTTGAATCACTGCGTTTCTCGAGAAACGCAGTGATTCAACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014219.1-859s1c1
Sequence:CCGGCAGGGAACAGAACAGCGAATACTCGAGTATTCGCTGTTCTGTTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)