EMAIL THIS PAGE TO A FRIEND

KIR2DL4

killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4

67 Gene Product Result for
Synonyms: CD158D G9P KIR103 KIR103AS
Species: Human KIR2DL4(3805)
Gene ID:
Human(3805) Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene is one of the 'framework' loci that is present on all haplotypes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002255 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116531 MISSION® esiRNA esiRNA human KIR2DL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080770 Rosetta Predictions human pricing
NM_001080772 Rosetta Predictions human pricing
NM_002255 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315950 predicted 1120
2 SASI_Hs02_00315951 predicted 1117
3 SASI_Hs02_00315952 predicted 204
4 SASI_Hs02_00315953 predicted 1032
5 SASI_Hs02_00315954 predicted 1078
6 SASI_Hs02_00315955 predicted 257
7 SASI_Hs02_00315956 predicted 1021
8 SASI_Hs02_00315957 predicted 1073
9 SASI_Hs02_00315958 predicted 905
10 SASI_Hs02_00315959 predicted 71
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315960 predicted 1226
2 SASI_Hs02_00315961 predicted 1225
3 SASI_Hs02_00315962 predicted 197
4 SASI_Hs02_00315963 predicted 1134
5 SASI_Hs02_00315964 predicted 1184
6 SASI_Hs02_00315965 predicted 265
7 SASI_Hs02_00315966 predicted 1129
8 SASI_Hs02_00315967 predicted 1170
9 SASI_Hs02_00315968 predicted 1010
10 SASI_Hs02_00315969 predicted 67
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134559 predicted 1223
2 SASI_Hs01_00134562 predicted 1228
3 SASI_Hs01_00134563 predicted 200
4 SASI_Hs01_00134566 predicted 1142
5 SASI_Hs02_00333505 predicted 1178
6 SASI_Hs02_00333506 predicted 258
7 SASI_Hs02_00333507 predicted 1130
8 SASI_Hs02_00333508 predicted 1180
9 SASI_Hs02_00333509 predicted 1011
10 SASI_Hs02_00333510 predicted 67
11 SASI_Hs01_00134560 predicted 248
12 SASI_Hs01_00134561 predicted 1200
13 SASI_Hs01_00134564 predicted 317
14 SASI_Hs01_00134565 predicted 486
15 SASI_Hs01_00134567 predicted 319
16 SASI_Hs01_00134568 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002255
KIR2DL4 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-1024s1c1
Sequence:CCGGGCGTGTGTATAGAACTTCCAACTCGAGTTGGAAGTTCTATACACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-554s1c1
Sequence:CCGGGCCCAGCATCAATGGAACATTCTCGAGAATGTTCCATTGATGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-757s1c1
Sequence:CCGGGACACCTGCATGCTGTGATTACTCGAGTAATCACAGCATGCAGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-209s1c1
Sequence:CCGGGTTTAACATCTTCACGCTGTACTCGAGTACAGCGTGAAGATGTTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-320s1c1
Sequence:CCGGGACCTACAGATGTCGAGGTTTCTCGAGAAACCTCGACATCTGTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002255.5-1505s21c1
Sequence:CCGGGGCATCAGCAAACCTTATAAACTCGAGTTTATAAGGTTTGCTGATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002255.5-406s21c1
Sequence:CCGGATATGAGAAACCTTCGCTTACCTCGAGGTAAGCGAAGGTTTCTCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002255
KIR2DL4 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-1024s1c1
Sequence:CCGGGCGTGTGTATAGAACTTCCAACTCGAGTTGGAAGTTCTATACACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-554s1c1
Sequence:CCGGGCCCAGCATCAATGGAACATTCTCGAGAATGTTCCATTGATGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-757s1c1
Sequence:CCGGGACACCTGCATGCTGTGATTACTCGAGTAATCACAGCATGCAGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-209s1c1
Sequence:CCGGGTTTAACATCTTCACGCTGTACTCGAGTACAGCGTGAAGATGTTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-320s1c1
Sequence:CCGGGACCTACAGATGTCGAGGTTTCTCGAGAAACCTCGACATCTGTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002255.5-1505s21c1
Sequence:CCGGGGCATCAGCAAACCTTATAAACTCGAGTTTATAAGGTTTGCTGATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002255.5-406s21c1
Sequence:CCGGATATGAGAAACCTTCGCTTACCTCGAGGTAAGCGAAGGTTTCTCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002255
KIR2DL4 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-1024s1c1
Sequence:CCGGGCGTGTGTATAGAACTTCCAACTCGAGTTGGAAGTTCTATACACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-554s1c1
Sequence:CCGGGCCCAGCATCAATGGAACATTCTCGAGAATGTTCCATTGATGCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-757s1c1
Sequence:CCGGGACACCTGCATGCTGTGATTACTCGAGTAATCACAGCATGCAGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-209s1c1
Sequence:CCGGGTTTAACATCTTCACGCTGTACTCGAGTACAGCGTGAAGATGTTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002255.3-320s1c1
Sequence:CCGGGACCTACAGATGTCGAGGTTTCTCGAGAAACCTCGACATCTGTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002255.5-1505s21c1
Sequence:CCGGGGCATCAGCAAACCTTATAAACTCGAGTTTATAAGGTTTGCTGATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002255.5-406s21c1
Sequence:CCGGATATGAGAAACCTTCGCTTACCTCGAGGTAAGCGAAGGTTTCTCATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)