EMAIL THIS PAGE TO A FRIEND

KIR2DL5A

killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A

13 Gene Product Result for
Synonyms: CD158F KIR2DL5 KIR2DL5.1 KIR2DL5.3 KIR2DL5B
UniProtKB ID: Q8N109
Gene ID:
Human(57292) Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]
cow(282860) killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020535 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020535 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133405 predicted 827
2 SASI_Hs01_00133406 predicted 498
3 SASI_Hs01_00133407 predicted 1060
4 SASI_Hs01_00133408 predicted 219
5 SASI_Hs01_00133404 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020535
KIR2DL5A MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020535.3-929s21c1
Sequence:CCGGGACCCTCAGGAGGTGACATATCTCGAGATATGTCACCTCCTGAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020535.3-397s21c1
Sequence:CCGGGATCGTGGTCACAGGTCTATTCTCGAGAATAGACCTGTGACCACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-705s1c1
Sequence:CCGGGAAACTCTTCAAGTAGTTCATCTCGAGATGAACTACTTGAAGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-493s1c1
Sequence:CCGGCAGGAGCTCATTTGACATGTACTCGAGTACATGTCAAATGAGCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-641s1c1
Sequence:CCGGTCTCTCCATGACTCACCCTATCTCGAGATAGGGTGAGTCATGGAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-205s1c1
Sequence:CCGGCTCTCGTCTTGGGTTTACCATCTCGAGATGGTAAACCCAAGACGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020535
KIR2DL5A MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020535.3-929s21c1
Sequence:CCGGGACCCTCAGGAGGTGACATATCTCGAGATATGTCACCTCCTGAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020535.3-397s21c1
Sequence:CCGGGATCGTGGTCACAGGTCTATTCTCGAGAATAGACCTGTGACCACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-705s1c1
Sequence:CCGGGAAACTCTTCAAGTAGTTCATCTCGAGATGAACTACTTGAAGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-493s1c1
Sequence:CCGGCAGGAGCTCATTTGACATGTACTCGAGTACATGTCAAATGAGCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-641s1c1
Sequence:CCGGTCTCTCCATGACTCACCCTATCTCGAGATAGGGTGAGTCATGGAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-205s1c1
Sequence:CCGGCTCTCGTCTTGGGTTTACCATCTCGAGATGGTAAACCCAAGACGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020535
KIR2DL5A MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020535.3-929s21c1
Sequence:CCGGGACCCTCAGGAGGTGACATATCTCGAGATATGTCACCTCCTGAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020535.3-397s21c1
Sequence:CCGGGATCGTGGTCACAGGTCTATTCTCGAGAATAGACCTGTGACCACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-705s1c1
Sequence:CCGGGAAACTCTTCAAGTAGTTCATCTCGAGATGAACTACTTGAAGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-493s1c1
Sequence:CCGGCAGGAGCTCATTTGACATGTACTCGAGTACATGTCAAATGAGCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-641s1c1
Sequence:CCGGTCTCTCCATGACTCACCCTATCTCGAGATAGGGTGAGTCATGGAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020535.1-205s1c1
Sequence:CCGGCTCTCGTCTTGGGTTTACCATCTCGAGATGGTAAACCCAAGACGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)