EMAIL THIS PAGE TO A FRIEND

KIR2DS4

killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4

41 Gene Product Result for
Synonyms: CD158I KIR1D KIR412 KKA3 NKAT8
Species: Human KIR2DS4(3809)
UniProtKB ID: P43632, Q6H2G7
Gene ID:
Human(3809) Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301224 ANTI-KIR2DS4 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2700088 Anti-KIR2DS4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012314 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012314 Rosetta Predictions human pricing
NM_178228 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192795 predicted 391
2 SASI_Hs01_00192796 predicted 322
3 SASI_Hs01_00192797 predicted 463
4 SASI_Hs01_00192798 predicted 401
5 SASI_Hs01_00192799 predicted 471
6 SASI_Hs01_00192800 predicted 326
7 SASI_Hs01_00192801 predicted 342
8 SASI_Hs01_00192802 predicted 416
9 SASI_Hs01_00192803 predicted 335
10 SASI_Hs01_00192804 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226889 predicted 332
2 SASI_Hs01_00226890 predicted 262
3 SASI_Hs01_00226891 predicted 389
4 SASI_Hs01_00226892 predicted 335
5 SASI_Hs01_00226893 predicted 403
6 SASI_Hs01_00226894 predicted 254
7 SASI_Hs01_00226895 predicted 270
8 SASI_Hs01_00226896 predicted 341
9 SASI_Hs01_00226897 predicted 269
10 SASI_Hs01_00226898 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012314
KIR2DS4 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000062867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012314.2-187s1c1
Sequence:CCGGGCAATGTTGGTCGGATGTCATCTCGAGATGACATCCGACCAACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012314.3-944s21c1
Sequence:CCGGGAGGTGTCATACGCATAATTGCTCGAGCAATTATGCGTATGACACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012314.3-236s21c1
Sequence:CCGGGGGAAGTTTAACAACACTTTGCTCGAGCAAAGTGTTGTTAAACTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012314
KIR2DS4 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000062867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012314.2-187s1c1
Sequence:CCGGGCAATGTTGGTCGGATGTCATCTCGAGATGACATCCGACCAACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012314.3-944s21c1
Sequence:CCGGGAGGTGTCATACGCATAATTGCTCGAGCAATTATGCGTATGACACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012314.3-236s21c1
Sequence:CCGGGGGAAGTTTAACAACACTTTGCTCGAGCAAAGTGTTGTTAAACTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012314
KIR2DS4 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000062867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012314.2-187s1c1
Sequence:CCGGGCAATGTTGGTCGGATGTCATCTCGAGATGACATCCGACCAACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012314.3-944s21c1
Sequence:CCGGGAGGTGTCATACGCATAATTGCTCGAGCAATTATGCGTATGACACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012314.3-236s21c1
Sequence:CCGGGGGAAGTTTAACAACACTTTGCTCGAGCAAAGTGTTGTTAAACTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)