EMAIL THIS PAGE TO A FRIEND

KIR3DL1

killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1

37 Gene Product Result for
Synonyms: CD158E1 KIR KIR3DL1/S1 NKAT3 NKB1 NKB1B
UniProtKB ID: P43629, O43473, Q14946, Q16541
Gene ID:
Human(3811) Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]
Mouse(245616) killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Rat(353253) killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
cow(353254) killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013289 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013289 Rosetta Predictions human pricing
NM_181479 Rosetta Predictions rat pricing
NM_177749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180737 predicted 199
2 SASI_Hs01_00180738 predicted 240
3 SASI_Hs01_00180739 predicted 210
4 SASI_Hs01_00180740 predicted 1384
5 SASI_Hs01_00180741 predicted 228
6 SASI_Hs01_00180742 predicted 519
7 SASI_Hs01_00180743 predicted 290
8 SASI_Hs01_00180744 predicted 837
9 SASI_Hs01_00180745 predicted 458
10 SASI_Hs01_00180746 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111349 predicted 305
2 SASI_Rn01_00111351 predicted 736
3 SASI_Rn01_00111352 predicted 561
4 SASI_Rn01_00111353 predicted 591
5 SASI_Rn01_00111354 predicted 530
6 SASI_Rn01_00111355 predicted 196
7 SASI_Rn01_00111356 predicted 427
8 SASI_Rn02_00269754 predicted 469
9 SASI_Rn01_00111357 predicted 668
10 SASI_Rn01_00111358 predicted 346
11 SASI_Rn01_00111350 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167067 predicted 1093
2 SASI_Mm01_00167066 predicted 1038
3 SASI_Mm02_00348129 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013289
KIR3DL1 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-448s1c1
Sequence:CCGGCCTGCAATGTTGGTCAGATATCTCGAGATATCTGACCAACATTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-1002s1c1
Sequence:CCGGCCACAGAACCAAGCTCCAAATCTCGAGATTTGGAGCTTGGTTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-832s1c1
Sequence:CCGGGCGCAAGGTCAACAGAACATTCTCGAGAATGTTCTGTTGACCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-202s1c1
Sequence:CCGGGCTATACAAAGAAGACAGAATCTCGAGATTCTGTCTTCTTTGTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-1288s1c1
Sequence:CCGGCCCTACAGATACCATCTTGTACTCGAGTACAAGATGGTATCTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013289.2-1210s21c1
Sequence:CCGGGCCAACAGCGAGGACTCTGATCTCGAGATCAGAGTCCTCGCTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013289.2-1560s21c1
Sequence:CCGGGCTTACAAATGTCTAGGTCCCCTCGAGGGGACCTAGACATTTGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013289
KIR3DL1 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-448s1c1
Sequence:CCGGCCTGCAATGTTGGTCAGATATCTCGAGATATCTGACCAACATTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-1002s1c1
Sequence:CCGGCCACAGAACCAAGCTCCAAATCTCGAGATTTGGAGCTTGGTTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-832s1c1
Sequence:CCGGGCGCAAGGTCAACAGAACATTCTCGAGAATGTTCTGTTGACCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-202s1c1
Sequence:CCGGGCTATACAAAGAAGACAGAATCTCGAGATTCTGTCTTCTTTGTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-1288s1c1
Sequence:CCGGCCCTACAGATACCATCTTGTACTCGAGTACAAGATGGTATCTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013289.2-1210s21c1
Sequence:CCGGGCCAACAGCGAGGACTCTGATCTCGAGATCAGAGTCCTCGCTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013289.2-1560s21c1
Sequence:CCGGGCTTACAAATGTCTAGGTCCCCTCGAGGGGACCTAGACATTTGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013289
KIR3DL1 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-448s1c1
Sequence:CCGGCCTGCAATGTTGGTCAGATATCTCGAGATATCTGACCAACATTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-1002s1c1
Sequence:CCGGCCACAGAACCAAGCTCCAAATCTCGAGATTTGGAGCTTGGTTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-832s1c1
Sequence:CCGGGCGCAAGGTCAACAGAACATTCTCGAGAATGTTCTGTTGACCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-202s1c1
Sequence:CCGGGCTATACAAAGAAGACAGAATCTCGAGATTCTGTCTTCTTTGTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013289.1-1288s1c1
Sequence:CCGGCCCTACAGATACCATCTTGTACTCGAGTACAAGATGGTATCTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013289.2-1210s21c1
Sequence:CCGGGCCAACAGCGAGGACTCTGATCTCGAGATCAGAGTCCTCGCTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013289.2-1560s21c1
Sequence:CCGGGCTTACAAATGTCTAGGTCCCCTCGAGGGGACCTAGACATTTGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177749
KIR3DL1 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177749.2-1344s1c1
Sequence:CCGGCCCTCTGAGTTCTCAAAGAAACTCGAGTTTCTTTGAGAACTCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-1026s1c1
Sequence:CCGGGCACATTCTAACTGGGCTCTTCTCGAGAAGAGCCCAGTTAGAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-1161s1c1
Sequence:CCGGCACAATAAACACACAGAACTTCTCGAGAAGTTCTGTGTGTTTATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-1171s1c1
Sequence:CCGGACACAGAACTTTGAAGGACAACTCGAGTTGTCCTTCAAAGTTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-334s1c1
Sequence:CCGGGCACATAGTGAGCCTCTGAAACTCGAGTTTCAGAGGCTCACTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177749.3-124s21c1
Sequence:CCGGTATCTGCCTGGCCAAGTTATGCTCGAGCATAACTTGGCCAGGCAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177749.3-674s21c1
Sequence:CCGGCATCAAGATCACAGGTATATACTCGAGTATATACCTGTGATCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177749
KIR3DL1 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177749.2-1344s1c1
Sequence:CCGGCCCTCTGAGTTCTCAAAGAAACTCGAGTTTCTTTGAGAACTCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-1026s1c1
Sequence:CCGGGCACATTCTAACTGGGCTCTTCTCGAGAAGAGCCCAGTTAGAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-1161s1c1
Sequence:CCGGCACAATAAACACACAGAACTTCTCGAGAAGTTCTGTGTGTTTATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-1171s1c1
Sequence:CCGGACACAGAACTTTGAAGGACAACTCGAGTTGTCCTTCAAAGTTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-334s1c1
Sequence:CCGGGCACATAGTGAGCCTCTGAAACTCGAGTTTCAGAGGCTCACTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177749.3-124s21c1
Sequence:CCGGTATCTGCCTGGCCAAGTTATGCTCGAGCATAACTTGGCCAGGCAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177749.3-674s21c1
Sequence:CCGGCATCAAGATCACAGGTATATACTCGAGTATATACCTGTGATCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177749
KIR3DL1 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177749.2-1344s1c1
Sequence:CCGGCCCTCTGAGTTCTCAAAGAAACTCGAGTTTCTTTGAGAACTCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-1026s1c1
Sequence:CCGGGCACATTCTAACTGGGCTCTTCTCGAGAAGAGCCCAGTTAGAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-1161s1c1
Sequence:CCGGCACAATAAACACACAGAACTTCTCGAGAAGTTCTGTGTGTTTATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-1171s1c1
Sequence:CCGGACACAGAACTTTGAAGGACAACTCGAGTTGTCCTTCAAAGTTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177749.2-334s1c1
Sequence:CCGGGCACATAGTGAGCCTCTGAAACTCGAGTTTCAGAGGCTCACTATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177749.3-124s21c1
Sequence:CCGGTATCTGCCTGGCCAAGTTATGCTCGAGCATAACTTGGCCAGGCAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177749.3-674s21c1
Sequence:CCGGCATCAAGATCACAGGTATATACTCGAGTATATACCTGTGATCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)